... Progress . ... RMA calls must have local semantics, except when required for synchronization with other RMA calls. ... On the origin process, an RMA communication may become enabled as soon as the corresponding put, get or accumulate call has executed, or as late as when the ensuing synchronization call is issued. ... This code will deadlock: the wait of process 1 blocks until process 0 calls complete, and the receive of process 0 blocks until process 1 calls send. ... Центры . ...

Еще в разделе: (Показать все результаты (>725) - www.parallel.ru/ )

• Clarification of MPI_FINALIZE | PARALLEL.RU - Информационно-аналитический центр
• Independence of Basic Runtime Routines | PARALLEL.RU -
• Semantic Terms | PARALLEL.RU - Информационно-аналитический центр по

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>556) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

Электронная библиотека Попечительского совета . ... Lau D. - Function Algebras on Finite Sets . ... Название: Function Algebras on Finite Sets . ... Functions which are defined on finite sets occur in almost all fields of mathematics. For more than 80 years algebras whose universes are such functions (so-called function algebras), have been intensively studied. ... Algebra of finite type 27 . ... Algebra, finite 26 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>16626) - lib.mexmat.ru/ )

• Поиск книг, содержащих Complete graph :: Электронная библиотека попечительского
• Smullyan R.M. - Recursion Theory for Metamathematics :: Электронная библиотека
• Stenstroem B. - Ring of quotients. Introduction to methods of ring theory ::

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3122) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

Recital . Character Mode Recital is a fully-functional Relational Database Management System and Fourth Generation Environment (RDBMS and 4GE) for Unix and OpenVMS systems. ... Recital will also open up access to your entire information systems environment by providing access to multiple database formats on both UNIX and VMS systems. ... Network access to Oracle, Ingres, Informix, DB2, and RDB data is handled with ease using the Recital Server Interface technology. ... Relational DBMS . ...

Еще в разделе: (Показать все результаты (>3666) - www.sai.msu.su/ )

• SAL- Programming - Tools & Utilities - GRASP
• SAL- Computer Graphics, Images Signals - Image Viewers, Conversions
• SAL- Programming - Languages Compilers - TowerEiffel

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>80) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>178) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• The Microsoft Machine Learning and Intelligence School will take place in Saint

-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash-completion-r1 git -2 elisp-common DESCRIPTION= Stores, retrieves, generates, and synchronizes passwords securely using gpg, pwgen, and git HOMEPAGE= http://www.passwordstore.org/ EGIT_REPO_URI= http:// git .zx2c4.com/password-store SLOT= 0 LICENSE= GPL-2 KEYWORDS= IUSE= + ...

Еще в разделе: (Показать все результаты (>20311) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-admin/pass/pass-1.6.5.ebuild
• http://mirror.msu.net/pub/rfc-editor/internet-drafts/draft-perkins-manet-using-rfc6621-00.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc225.txt.pdf

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>12704) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 40c086a41ca0 .hgignore

PHP Manual . ... Parsing and execution are now two completely separated steps, no execution of a files code will happen until the complete file and everything it requires has completely and successfully been parsed. One of the new requirements introduced with this split is that required and included files now have to be syntactically complete. You can no longer spread the different controlling parts of a control structure across file boundaries. ... Migrating Configuration Files . ...

Еще в разделе: (Показать все результаты (>461) - oit.cmc.msu.ru/ )

• flock
• readline_completion_function
• Overview

... Glossary of the laboratory-chair . ... Institute Laboratory-Chairs . ... Laboratory-chair of modelling the natural references of time . ... All natural systems are considered as hierarchic systems. ... These flows are called generating flows. ... The union of all sets of elements of a system's generating flows is considered as its space or medium. ... The formation, or the course of time, in systems is considered as changing the amount of substance of some generating flows in these systems. ...

Еще в разделе: (Показать все результаты (>446) - chronos.msu.ru/ )

• TIME AS PROCESS FUNCTION

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Test data generation for core-level verification of FIFO cache memory" . Kornykhin E.V. The generation of cache initial state for microprocessor testing with the aid of test templates is considered. ... The initial state generation of the cache memory is performed by resolving the constraints composed for a test template. Keywords: FIFO, constraints, system functional testing, core-level verification, test templates . PostScript (in Russian) (591KB) . PDF (in Russian) (196KB) . ...

Еще в разделе: (Показать все результаты (>478) - num-meth.srcc.msu.ru/ )

• "Generation of cycles of map cells for a simple planar graph"
• "A detection method for mass-generated unnatural texts based on the topical
• "Mathematical simulation of unsteady three-dimensional processes in the space

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Generate More Sales By Using These SEO Ti . ... It really is more efficient than the usual link exchange, and both sites receive new content. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>5539) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Generate More Sales With One Of
• Экологический Форум - Фундаментальная Экология: Over nearly the complete
• Экологический Форум - Фундаментальная Экология: that will generate a peril on

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>135) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

A problem, that can arise when moving from Fortran 77 to Fortran 90, is dependent on a usual deviation from the standard, and has to do especially with user programs. ... With many Fortran 77 implementations we wrote PROGRAM TEST REAL X WRITE(*,10) 10 FORMAT('Give X = ',$) READ(*,*) X WRITE(*,*) X END In Fortran 90 we use "non-advancing I/O" instead. ... In some old Fortran dialects the statement TYPE was used to write on a typewriter terminal and PRINT was used to write on the line printer. ...

Еще в разделе: (Показать все результаты (>16668) - crydee.sai.msu.ru/ )

• Notation
• Historical Notes
• Recursion

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>161) - hist.msu.ru/ )

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>1697) - chem.msu.ru/ )

• Systematical Search for New Types of Chemical Interconversions: Mathematical
• Moscow University Chemistry Bulletin Vol. 48, No. 2, P. 86 (2007)
• Moscow University Chemistry Bulletin Vol. 43, No. 6, P. 381 (2002)

... To create a Hysteresys calibration file user should do the following: . Nodal points with known distances between them should be marked using poly line (Curve) on the obtained image of a calibration sample. ... Figure 2.12: Table that allow to define points that are needed for calibration plots generation. ... In this case user should obtain two separate calibration files for fast and slow scanning direction(x-calibration Х y-calibration-slow). ... Then we should unite these two files in one. ...

Еще в разделе: (Показать все результаты (>151) - www.spm.genebee.msu.ru/ )

• Redoubling an image

... TWiki ? TWikiSiteTools . ... In particular, TWiki provides two highly configurable, automated site monitoring tools, WebNotify , to email alerts when topics are edited, and WebStats , to generate detailed activity reports. ... The script sends an automated email to subscribed users if topics were changed in a web within last interval. ... You can use the topic in the Main web as a template. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiSiteTools . ...

Еще в разделе: (Показать все результаты (>36618) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (2 vs. 3) - TWiki
• TWikiUIViewDotPm - TWiki - TWiki