Application of evolutionary model in the evaluation of the quality of pair wise alignment of amino acid sequences Valery Polyanovsky, V. G. Tumanyan Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia ... : polyanovskyvo@mailfrom.ru, tuman@eimb.ru The purpose of the work is to develop a universal method for estimating the pairwise alignment quality depending on the evolutionary distance (degree of homology) between the ... REFERENCES 1. ...

Еще в разделе: (Показать все результаты (>239) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/161.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/164.pdf

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>189) - www.genebee.msu.ru/ )

• AliComp - GeneBee Alignment Comparison Help
• AliComp - GeneBee Alignments Comparison - Advanced
• IGLA-3D User Guide

Some additional inquiry information . ... help information) . Here you can read some articles, describing details of calculting process. We hope, after having these articles read, you'll surely know, what and how does this program work. Alignment formats . ... WPGMA - method for sequence weighting and tree constructing . Alignment quality estimation: "The rule of fours" . Phylogenetic tree schemes . Criteria of branch quality . Evolution reconstruction: parsimony method . ...

Еще в разделе: (Показать все результаты (>482) - monkey.belozersky.msu.ru/ )

• Inquiry information || Formats of alignments
• About authors ot this complex
• SDP home page

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• ConClus
• Align tool for DNA-protein complexes
• Comparison of protein phylogeny reconstruction methods

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>6979) - mouse.belozersky.msu.ru/ )

... MSU Codec Comparison aims to deliver high quality comparisons of video encoders to both industrial and scientific communities. ... The newest versions of MPEG-4 codecs comparison for their using by an ordinary user for home video compression. ... First Annual MPEG-4 AVC/ H.264 Video Codecs Comparison (January 2005) . ... Second Annual MPEG-4 AVC/H.264 Video Codecs Comparison(December 2005) . ... Third Annual MPEG-4 AVC/H.264 Video Codecs Comparison (December 2006) . ... Fifth H.264 codecs comparison...

Еще в разделе: (Показать все результаты (>300) - graphics.cs.msu.ru/ )

• MSU Video Codec Comparison | Лаборатория компьютерной графики и мультимедиа
• Age Estimation Using Additional Unlabeled Face Images | Graphics and Media Lab
• GML AdaBoost Matlab Toolbox | Лаборатория компьютерной графики и мультимедиа

A comparison of algorithms for spiral tomography" . Pickalov V.V. and Likhachev A.V. The paper deals with the three-dimensional transmission tomography problem. ... The main attention is paid to the comparison of the algorithms based on the equations of quasi-exact inversion with the approximate iterative method ART. ... PostScript (in Russian) (8.33MB) . PDF (in Russian) (765KB) . ... Pickalov V.V. and Likhachev A.V. e-mail: pickalov@itam.nsc.ru ; http://www.itam.nsc.ru/lab17 ...

Еще в разделе: (Показать все результаты (>432) - num-meth.srcc.msu.ru/ )

• "Comparison of the Verlet table and cell-linked list algorithms for sequential,
• "Screen video compression with a video card. Comparison of technologies"
• "A comparison of explicit and implicit numerical methods for solving

Электронная библиотека Попечительского совета . ... Althaus E. - A branch-and-cut algorithm for multiple sequence alignment . ... Название: A branch-and-cut algorithm for multiple sequence alignment . Автор: Althaus E. Язык: . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>9154) - lib.mexmat.ru/ )

• Ng E.W. - A Comparison of Computational Methods and Algorithms for the Complex
• Lander E.S., Waterman M.S. (eds.) - Calculating the Secrets of Life:
• Al-Hakim L., Memmola M. - Business web strategy: design, alignment and

FASTA /TFASTA/FASTX/TFASTXv3(1) FASTA /TFASTA/FASTX/TFASTXv3(1) NAME fasta3, fasta3_t - scan a protein or DNA sequence library for similar sequences tfasta3, tfasta3_t - compare a protein sequence to a DNA sequence library , translating the DNA sequence library `on-the-fly'. fastx3, fastx3_t - compare a DNA sequence to a protein sequence ... REF_URL the format string used to define the option to lookup the library sequence in entrez, or some other database. ...

Еще в разделе: (Показать все результаты (>2141) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/year_04/doc/BLAST_help/bl2seq.html
• http://kodomo.cmm.msu.ru/~ellys/blosum.html
• SDPpred

A problem, that can arise when moving from Fortran 77 to Fortran 90, is dependent on a usual deviation from the standard, and has to do especially with user programs. ... With many Fortran 77 implementations we wrote PROGRAM TEST REAL X WRITE(*,10) 10 FORMAT('Give X = ',$) READ(*,*) X WRITE(*,*) X END In Fortran 90 we use "non-advancing I/O" instead. ... In some old Fortran dialects the statement TYPE was used to write on a typewriter terminal and PRINT was used to write on the line printer. ...

Еще в разделе: (Показать все результаты (>3702) - crydee.sai.msu.ru/ )

• Appendix D: The grammar of CSS2

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>142) - bioinf.fbb.msu.ru/ )

• SDPpred
• SDPsite - Algorithm Format requirements
• Algorithm

... blocks3d/www: mark conservative columns inside blocks Previously letters were marked if column is conservative over all sequences of alignment. ... Additional attribute storing conservatism of columns inside block was added to block. ... 21 in_block = False . ... 24 in_block , was_in_block = is_good_window ( window ), in_block . 25 if in_block and not was_in_block : . ... Block . ... 32 def blocks_markup ( alignment , blocks ): . ... 36 for column in block . ... in_block for column in alignment . ...

Еще в разделе: (Показать все результаты (>27781) - kodomo.fbb.msu.ru/ )

• allpy: d9a3e99ae19b test/usecase1.py
• allpy: 5091fef2ad88 lib/project.py
• allpy: allpy/base.py history

... PHP 4 >= 4.0.0) strnatcmp -- String comparisons using a "natural order" algorithm . ... This function implements a comparison algorithm that orders alphanumeric strings in the way a human being would, this is described as a "natural ordering". ... arr1 = $arr2 = array("img12.png","img10.png","img2.png","img1.png"); echo "Standard string comparison\n"; usort($arr1,"strcmp"); print_r($arr1); echo "\nNatural order string comparison\n"; usort($arr2,"strnatcmp"); print_r($arr2); . ...

Еще в разделе: (Показать все результаты (>208) - oit.cmc.msu.ru/ )

• strnatcasecmp
• Mcrypt Encryption Functions
• Comparison Operators

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>130) - hcs.cmc.msu.ru/ )

• Additional Education | Магистерское и послевузовское образование
• Master program "Mathematical Models of Complex Systems" | Магистерское и
• Master program "Mathematical and computer methods of image processing" |

Independent Submission S. Turner Request for Comments: 7093 IECA Category: Informational S. Kent ISSN: 2070-1721 BBN J. Manger Telstra December 2013 Additional Methods for Generating Key Identifiers Values Abstract This document specifies additional example methods for generating Key Identifier values for use in the AKI (Authority Key Identifier) and SKI (Subject Key Identifier) certificate extensions. ... Turner, et al. Informational [Page 1] RFC 7093 Additional Examples For KIs December 2013 1. ...

Еще в разделе: (Показать все результаты (>15511) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc7093.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5843.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5843.txt.pdf

... Class Member Functions for MPI . ... Besides the member functions which constitute the C++ language bindings for MPI, the C++ language interface has additional functions (as required by the C++ language). ... The complete set of C++ language bindings for MPI-1 is presented in Annex MPI-1 C++ Language Binding . ... Except where indicated, all non-static member functions (except for constructors and the assignment operator) of MPI member classes are virtual functions. ... Центры . ...

Еще в разделе: (Показать все результаты (>456) - www.parallel.ru/ )

• MPI_Intercomm_merge | PARALLEL.RU - Информационно-аналитический центр по
• Comparison | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Fri Oct 25 14:19:33 MSK 2013 . Previous message: [RU-NGI] SL6 additional RPMs . Next message: [RU-NGI] proxy @ nagios - rnag1.grid.kiae.ru . Messages sorted by: [ date ] [ thread ] [ subject ] [ author ] . On Fri, 25 Oct 2013, Victor Kotlyar wrote: > Всем доброго дня! ... Виктор > _______________________________________________ > RU-NGI mailing list > RU-NGI at theory.sinp.msu.ru > http://theory.sinp.msu.ru/mailman/listinfo/ru-ngi > -- Best regards, Valery Mitsyn . ...

Еще в разделе: (Показать все результаты (>1459) - theory.sinp.msu.ru/ )

• calg:dubna07:abstracts [THEP]
• [RU-NGI] proxy @ nagios - rnag1.grid.kiae.ru

An Aurora Before the Storm . ... Credit Copyright: Jan Curtis ( U. Alaska ), ACRC . Explanation: Early April brought some of the most intense auroral storms this decade. ... Auroral activity occurs high in the Earth's atmosphere and is a direct result of storms on our Sun . As huge sheets of charged particles stream out from the Sun, a small fraction of these particles are funneled in by Earth's magnetic field and strike atoms high in the atmosphere, causing the sky to glow. ...

Еще в разделе: (Показать все результаты (>4697) - www.astronet.ru/ )

• Астронет > An Aurora Before the Storm
• An Aurora Before the Storm
• Journal "Peremennye Zvezdy" > PZ: main journal.

Subdeletion structures as additional evidence for different analysis of synthetic and analytic comparatives in Russian In Russian there are two seemingly interchangeable comparative forms of adjectives: synthetic (the suffix -ee) and analytic (the word bolee). ... One more peculiar characteristic pertaining to synthetic rather than analytic comparatives in Russian is the inability of the former to appear in so-called subdeletion structures. ... Masa vyse Vani. i(analytic+GEN). ... Pancheva, Roumyana. ...

Еще в разделе: (Показать все результаты (>234) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/brykina.pdf
• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/oskolskaya.pdf
• http://www.philol.msu.ru/~rlc2010/abstracts/rlc2010_abstracts_sem20.pdf

... Define a callback that takes two parameters like this: function getDateText(date, d) . ... This function must return the text to be inserted in the cell of the passed date. ... For a better way, see the source of this page and note the usage of an externally defined "dateText" object which maps "date" to "date info", also taking into account the year and month. This object can be easily generated from a database, and the getDateText function becomes extremely simple (and static). ...

Еще в разделе: (Показать все результаты (>32998) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (1 vs. 2) - TWiki
• TWikiNetSkin - TWiki - TWiki
• TWikiNetSkin < TWiki < TWiki