Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...

Еще в разделе: (Показать все результаты (>36) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Eugene S. Soldatov
• About laboratory

... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...

Еще в разделе: (Показать все результаты (>6) - geophys.srcc.msu.ru/ )

Russia 2010: Russian Transformations in the Context of World Development V.B.Kuvaldin Introduction: The Second Coming of Capitalism to Russia A quarter century has passed since the start of Gorbachevs perestroika. ... 21 World Economic Outlook. ... In this case Russia will have the opportunity to enjoy long-term growth at a rate exceeding the current trend in world economy (economic growth of about 3-4 percent a year over the last decade) and to strengthen her overall positions in world economy. ...

Еще в разделе: (Показать все результаты (>12) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Text_Eng.pdf
• http://www.mse-msu.ru/sc_pub/golovnin_sc_pub_2010_en.pdf

ARTICLE IN PRESS Journal of Sound and Vibration 267 (2003) 1047 ­ 1064 JOURNAL OF SOUND AND VIBRATION www.elsevier.com/locate/jsvi Interaction of eigenvalues in multi-parameter problems A.P. Seyranian*, A.A. Mailybaev Institute of Mechanics, Moscow State Lomonosov University, Michurinsky pr. ... Both complex and real eigenvalues are considered. ... Two simple real eigenvalues approach, and then diverge as Dp1 is changed; a double eigenvalue does not appear; see Fig. ... Imz z 2 0 z 1 Rez Fig. ...

Еще в разделе: (Показать все результаты (>25) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/reviews/Chillingworth.pdf
• http://mailybaev.imec.msu.ru/reviews/Olhoff.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev1999b.pdf

... MSU Chamber Orchestra . The Alia . This page contains information about the musicians who have played in our orchestra (see "members" for the current season team). Unfortunately, we have no pictures of all the people who played in the orchestra, and the available photos differ significantly in their quality. ... violini II) . ... viole) . Elena . ... violini I and II) . ... Natalia . ... violini I and II, viole) . ... celli) . ... Julia . ... violini I, viole) . ...

Еще в разделе: (Показать все результаты (>4) - music.genebee.msu.ru/ )

• C. Gibbons, M. Locke: Cupid and Death - Entry 1
• G. F. Handel: Theodora - Part 1

... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...

Еще в разделе: (Показать все результаты (>3) - geol.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>5) - srd.sinp.msu.ru/ )

Cosmic Research, Vol. 42, No. 5, 2004, pp. 435­488. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 453­508. Original Russian Text Copyright © 2004 by Veselovsky, Panasyuk, Avdyushin, Bazilevskaya, Belov, Bogachev, Bogod, Bogomolov, Bothmer, Boyarchuk, Vashenyuk, Vlasov, Gnezdilov, Gorgutsa, Grechnev, Denisov, Dmitriev, Dryer, Yermolaev, Eroshenko, Zherebtsov, Zhitnik, Zhukov, Zastenker, Zelenyi, Zeldovich, Ivanov-Kholodnyi, Ignat'ev, Ishkov, Kolomiytsev, Krasheninnikov, Kudela,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/pansyketal.pdf

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf

... Division of General Nuclear Physics MSU . ... INP MSU . ... Faculty of Physics MSU . ... The ANTARES project is the largest project on registration astrophysical neutrino by detection of cherenkov radiation from secondary particles, arising by neutrino interaction with substance of the Earth. ... Since June, 2009 the group of the Lomonosov Moscow State University takes part in the project. ... Our group consists of young researchers of MSU Skobeltsyn Nuclear Physics Institute and Faculty of Physics....

Еще в разделе: (Показать все результаты (>10) - antares.sinp.msu.ru/ )

• ANTARES в МГУ

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>3) - discours.philol.msu.ru/ )

... In general, the entire flow domain in the entry region of a channel can be split into five asymptotic domains Fig. 2 : 1 the region of a uniform free stream, where the parameters are the same as in the inlet section the fluid velocity and particle concentration profiles are uniform and the particle slip velocity is zero , 2 the boundary layer on the channel wall, where the fluid velocity profile is nonuniform, ... The particle concentration is found from explicit formula 22 ....

Еще в разделе: (Показать все результаты (>15) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk_22_12.doc

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>4) - np-chair.sinp.msu.ru/ )

Program XXXVI International Conference of the Russian Society for American Culture Studies Nature and Sustainability of Culture Moscow, December 3-10, 2010 Section 1. ... Nature in the nineteen-century American culture (The concept of Nature and its evolution from Romanticism to Naturalism. ... O.Y. Danchevskaya Moscow State Pedagogical University, Moscow, Russia Concept of Soul among North American Indians Soul is probably the most vital notion in any religion, though ideas about it vary greatly. ...

Еще в разделе: (Показать все результаты (>20) - www.journ.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out

... The S.P.Novikov Seminar came into being in the mid-sixties. ... 1] L.A.Alaniya, On manifolds of the Alexander type// Uspekhi Mat. Nauk, V. 46 ,1991, P. 179-180. ... Nauk SSSR, V.43, 1979, P. 104-240. ... 11] V.M.Bukhshtaber, A.S.Mishchenko, S.P.Novikov, Formal groups and their role in the apparatus of algebraic topology// Uspekhi Mat. ... Some applications to differential topology and to the theory of characteristic classes// Izv.Akad.Nauk SSSR, V. 34, 1970 I N2, P. 253-288; II: N3, P. 475-500. ...

Еще в разделе: (Показать все результаты (>63) - higeom.math.msu.su/ )

• Conferences (English)
• Index of /~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2004
• C*-algebras: Talks

... Letter of Application . ... Minilecture: How to organise information in the letter of application. When one applies for a position in a company, the letter of application cannot and should not contain all the information a prospective employer wants to know about you. ... If you know about a job opening within the company, refer directly to that position; if some person from that company told you of the job opening, you may begin the first paragraph by mentioning this person by name. ...

Еще в разделе: (Показать все результаты (>7) - anazarenko.ffl.msu.ru/ )

... Труды ЗБС . ... Новости . 2014 . ... Программа лекций на практике на ЗБС МГУ, лето 2014. ... Звенигородская биологическая станция ? ... Звенигородская биологическая станция имени С.Н. Скадовского Биологического факультета Московского государственного университета имени М.В. Ломоносова является учебно-научным центром междисциплинарных фундаментальных и прикладных исследований, . ... 12, МГУ, Биологический ф-т., . ... 2016 Звенигородская биологическая станция имени С.Н.Скадовского . ...