... Science and education . ... Scientific Laboratories . ... Science . ... Education . 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of Terahertz Optoelectronics and Spectroscopy . ... Angeluc Andrey Aleksandrovich researcher, Ph.D. Balakin Aleksey Vyacheslavovich researcher . ... Terahertz emission from femtosecond laser filaments . ... All laboratory`s grants . ...

Еще в разделе: (Показать все результаты (>293) - ofvp.phys.msu.ru/ )

• Laboratory of solid-state lasers and coherent spectroscopy
• Laboratory of photonics and nonlinear spectroscopy

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>17) - angel.cs.msu.su/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>550) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: CERN CA Website IP change
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,
• rfbr:rest:jobschema [THEP]

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>4877) - kodomo.fbb.msu.ru/ )

• allpy: log

Comparative metabolomic profiling of desiccation tolerant midge Elena Shagimardanova, T. Kikawada and O. Gusev Kazan Federal University, Kazan, Kremlevskaya str, 180pt), rjyka@mail.ru T. Kikawada National Institute of Agrobiological sciences, Tsukuba, Japan, kikawada@affrc.go.jp O.A. Gusev RIKEN Preventive Medicine & Diagnosis Innovation Program (PMI), RIKEN, Yokoh ama, Japan, gaijin.ru@gmai.com There are organisms of different complexity, which can survive complete water loss conditions. ...

Еще в разделе: (Показать все результаты (>198) - mccmb.belozersky.msu.ru/ )

• MCCMB'13

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>56) - vestnik.math.msu.su/ )

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>51) - rswater.phys.msu.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>3) - bioinf.fbb.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>261) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>65) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>21) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>207) - itpm.msu.su/ )

• perchild - Apache HTTP Server
• Kernel Options in 1.0 and Higher
• The Network File System

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>126) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>203) - uneex.lorien.cs.msu.su/ )

• perchild - Apache HTTP Server
• Real-World Package Building
• Conditionals

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>62) - uneex.mithril.cs.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>72) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>54) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

.

40. Leading scientific fellow Sergey Piskarev Ph.D.