... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>176) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/nekrasov.pdf

... Client/Server Examples . ... Up: Client/Server Examples Next: Ocean/Atmosphere - Relies on Name Publishing Previous: Client/Server Examples . The following example shows the simplest way to use the client/server interface. ... Up: Client/Server Examples Next: Simple Client-Server Example. ... MPI_Open_port(MPI_INFO_NULL, port_name); MPI_Publish_name("ocean", MPI_INFO_NULL, port_name); . ... MPI_Comm_connect( port_name, MPI_INFO_NULL, 0, MPI_COMM_WORLD, &server ); . ... Центры . ...

Еще в разделе: (Показать все результаты (>699) - www.parallel.ru/ )

• Clarification of MPI_FINALIZE | PARALLEL.RU - Информационно-аналитический центр
• Independence of Basic Runtime Routines | PARALLEL.RU -
• Error Handling | PARALLEL.RU - Информационно-аналитический центр по

This module provides for server-side imagemap processing. ... Configurable generation of imagemap menus. The lines in the imagemap files can have one of several formats: directive value [x,y ...] . ... The directives can come in any order, but are processed in the order they are found in the imagemap file. base Directive . ... Module: mod_imap . ... Its value is overridden by a default directive within the imagemap file. ... Its value is overridden by a base directive within the imagemap file. ...

Еще в разделе: (Показать все результаты (>102) - neptun.sai.msu.ru/ )

• Apache module mod_expires
• Apache module mod_dir
• Apache modules

PC GAMESS/Firefly' LINEAR SCALING QFMM-BASED CODE FOR LARGE-SCALE DIRECT HF DFT. ... This step is performed using FMM (fast multipole method) technique. ... At present, there are two algorithms implemented in the PC GAMESS/Firefly to perform this step. ... The following is the description of the generic QFMM options common to both GAMESS (US) and the PC GAMESS/Firefly: $FMM group (relevant if QFMM selected in $INTGRL) This group controls the quantum fast multipole method evaluation of Fock matrices. ...

Еще в разделе: (Показать все результаты (>114) - classic.chem.msu.su/ )

• Firefly and PC GAMESS Version History
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• PC GAMESS/Firefly DOCUMENTATION - TDDFT

Natural Satellites Data Center NSDC . ... Natural Satellites Ephemerides Server MULTI-SAT. ... OF NATURAL PLANETARY SATELLITES. ... A light movement of your arm ... and all necessary data are instantly available on your computer screen. ... New orbital models for all the new faint satellites of Jupiter, Saturn, Uranus and Neptune were determined independently from other authors on the basis of all published observations using numerical integration method applied to the equations of satellites motions. ...

Еще в разделе: (Показать все результаты (>386) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>16) - www.issp.ac.ru/ )

• International Science Olympiads

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>11876) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• cca: Automata.py history
• allpy: 40c086a41ca0 .hgignore

... Russian language courses: During academic year Summer courses Full-time Part-time Courses dates: from _____( day )____________( month )_____( year ) to ____( day )___________( month )______( year ) Information for visa support Citizenship __________________________________________(if more than one, please indicate them using comas) Place of birth ____________________________( country )_______________________________________ ____( ...

Еще в разделе: (Показать все результаты (>78) - www.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Subject : J Abel Comments on papers . From : Jennifer Abel < jabel@rodaleinst.org > . ... I have read with great interest many of the papers posted on the Privatization conference. ... Reed and Nikolsky on agrarian reform failures and suggestions intriguing. ... The relatively "modest" decline of the past 5 years can be attributed to the fact that agriculture had good resources around 1991 including proper equipment and land in good condition. By 1995 agriculture had exhausted these resources. ...

Еще в разделе: (Показать все результаты (>512) - www.fadr.msu.ru/ )

• A LITTLE COMMENT to the Commentary about Soils, Paleosols and Geosols by Vance
• EcoPhoto - Архив - Небесные явления Supernal phenomenons
• EcoPhoto - Архив - Камчатка - Мир бурого медведя

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>897) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Moscow University Chemistry Bulletin Vol. 48, No. 2, P. 86 (2007)
• Dmitriy Mendeleev Online

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>73) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc
• http://acat02.sinp.msu.ru/presentations/brun/Exercises_2.doc

This module is contained in the mod_imap.c file, and is compiled in by default. ... This module is in the default Apache distribution. ... Default <BASE> assignment through a new map directive base . ... The ImapDefault directive sets the default default used in the imagemap files. ... The ImapBase directive sets the default base used in the imagemap files. ... Menu text" . ... The directives can come in any order, but are processed in the order they are found in the imagemap file. base Directive . ...

Еще в разделе: (Показать все результаты (>804) - rtm-cs.sinp.msu.ru/ )

• Apache module mod_dir
• The Apache TPF Port
• Transparent Proxy with Squid mini-HOWTO

... About lab . ... Selected publications . Publications . ... Conference "GraphiCon" . Online Journal "Computer graphics and multimedia" (in russian) . ... Automatic building texture completion . Publication Type . Conference Paper . Year of Publication . ... Conference Name . ... Publication Language . ... http://graphics.cs.msu.ru/en/publications/text/gc2006kv.pdf . ...

Еще в разделе: (Показать все результаты (>234) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• Traffic sign recognition | Graphics and Media Lab

... Юрий (admin) Новости R , полезные советы , работа с данными No Comments . ... Юрий (admin) Новости R , анализ и визуализация данных , большая пятерка , корреляция , представление результатов , психометрика , статистика No Comments . ... Юрий (admin) Новости виртуальные исследования , опросы , психологические исследования No Comments . ... Юрий (admin) Новости ассессмент , виртуальные исследования , исследования , опросы , оценка персонала , центр оценки No Comments . ... ЖЖ-сообщество ?RU_SPSS? ...

Еще в разделе: (Показать все результаты (>170) - tukachev.flogiston.ru/ )

• Tag: SPSS Evaluation Version
• Tag: R
• Tag: SPSS

... Bulletin of experimental biology and medicine [Bull exp biol med] . Common information . ... no information] . ... since 1980-01-01 till today . ... medicine . ... In russian till 1936. ... Russian Academy Of Medical Sciences (RAMS) . ... http://medi.ru/doc/80.htm . ...

Еще в разделе: (Показать все результаты (>553) - journals.genebee.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> Complete Savages . Пользователи . Демо . Деньги . Фильмы . Форум . Complete Savages . США 2004 . отметить . Сериал . Комедия .

Еще в разделе: (Показать все результаты (>188) - kinfo.ru/ )

• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

... Fiber optic hidrophones . ... A fiber optic air backed mandrel hydrophone to detect high energy hadronic showers in the water". ( text ) . ... The realization of an optic fiber air backed mandrel hydrophone for frequencies up to 20 kHz". ( text ) . M. Anghinolfi, A. Bersani, A. Calvi, A. Cotrufo, M. Ivaldi, O. Ershova, F. Parodi, D. Piombo, A. Plotnikov and L. Repetto "Measurement of the frequency responsivity of a fiber optic air backed mandrel hydrophone up to 10 kHz in air". ( text ) . ...

Еще в разделе: (Показать все результаты (>18) - antares.sinp.msu.ru/ )

Comment on the International Jubilee Symposium . ... The usefulness of the Internet as a method of holding international meetings without the expense of travel is also clear, but this new medium is not yet well established in this role. ... How can we move on with international cooperation in the World Wide Web era? I would like to suggest that NASA's Planetary Data System is a good model. ... At the same time, much might be done with older images, by scanning prints to create new digital files. ...

Еще в разделе: (Показать все результаты (>92) - selena.sai.msu.ru/ )

• Comment
• Comments on the regular wave planetology

Effective Lagrangian analysis of observed Higgs -like boson V. Bunichev Mosow State University In collaboration with E. Boos, M. Dubinin, Y. Kurihara V. Bunichev , SINP MSU QFTHEP 2013 1 Higgs -like Boson M = 125 G eV Production of Higgs -boson: Gluon fusion Vector boson fusion Assotiated production Top quark fusion V. Bunichev , SINP MSU QFTHEP 2013 2 Higgs Signals: (vbf) WW bb ZZ V ... V. Bunichev, SINP MSU QFTHEP 2013 15 ...

Еще в разделе: (Показать все результаты (>192) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/Bunichev_singletop_tWb_LHC.pdf
• http://qfthep.sinp.msu.ru/talks2011/asymbrane_QFTHEP11.pdf
• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf