Registration completed on this website places you onto the symposium participants list. ... You must confirm your participation in the symposium at the registration desk located in the lobby of "Small Biological Auditorium MI" (Malaya Biologicheskaya) on the second floor of the south wing of the Biological Faculty building. ... Please clearly display your badge while you are inside of the building. ... If you plan to attend, please fill out respective line in the registration form. ...

Еще в разделе: (Показать все результаты (>144) - www.genebee.msu.ru/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>131) - hist.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>126) - www.msm.biophys.msu.ru/ )

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>51) - rswater.phys.msu.ru/ )

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>107) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• michael kors outlet uk This makes a rather convincing case for the
• editor | С Днем Победы!

Prague, August 16, 2006 . I am going to suggest the IAU Division V and Commission 27 a draft of a new GCVS classification scheme. ... It will also be available, after the GA, at the GCVS web site ( http://www.sai.msu.ru/groups/cluster/gcvs/ ) . We will start applying the scheme in the nearest future but are ready to take into account the future C27 suggestions, probably to be finally approved during the next GA of the IAU. ...

Еще в разделе: (Показать все результаты (>71) - sai.msu.ru/ )

EPFL application procedure and on-line application form for the incoming exchange students to EPFL during 2013/2014 is now available on our website: http://sae.epfl.ch/exchange-incoming We remind that our application procedure has to be completed online only and therefore no paper forms and documents (such as transcript of records, passport copy, CV, etc...) have to be sent to us. ... We advise them to contact your students currently on exchange at EPFL to request some help. ...

Еще в разделе: (Показать все результаты (>173) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/ac4/firstcircular.pdf

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>6) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

I was born on July, 8, 1988 in Perm, Russia. ... June 2004 . ... September 2004 . till July 2009 . student of Perm State University, Faculty of Physics. Speciality: Condensed Matter Physics. 2006 . ... specialization and practice on Chair of Physics of Phase Transitions. July 2009 . graduated from Perm State University, specialist in Condensed Matter Physics. ... PhD-student in Lomonosov Moscow State University, Faculty of Physics, Chair of Polymer and Crystal Physics. ...

Еще в разделе: (Показать все результаты (>242) - polly.phys.msu.ru/ )

• Science
• NATO Scientific Environmental Affairs
• NATO Scientific & Environmental Affairs

Title Author Key words Suicides in the United Kingdom (1981­2011): dynamics, trends, especially S.V. Bogdanov, J.S. Bogdanova suicide, UK, men, women, age groups The dynamics completed suicides in the UK over the years 1981­2011. Discusses the distribution of suicides by sex, age. The geographical distribution of suicide mortality of the UK population by region. Abstract

Еще в разделе: (Показать все результаты (>38) - www.socio.msu.ru/ )

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>78) - monkey.belozersky.msu.ru/ )

• SCOP classification
• Homeodomain numeration assumed

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:14 Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( modified ) Completed Automata: change_size, import from State, default states Sat , 04 Dec 2010 19:51:23 GMT Ilia [19:3d1a72f49417] * Interface.py ( modified ) little corrections Sat , 04 Dec 2010 19:42:50 GMT is_rusinov [18:d2705c3ee7a7] * ...

Еще в разделе: (Показать все результаты (>185) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=749533cdfc67782471aea02a0e4a1859de8ef2bd&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&stop_rev=19%3A3d1a72f49417&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=22%3A749533cdfc67&limit=100&mode=stop_on_copy

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>95) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>165) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>179) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server
• uucico Command Line Options

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>48) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX
• PspoClasses/080708/01IptablesTheory - UNИX

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>115) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>267) - www.philol.msu.ru/ )