... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>72) - www.enzyme.chem.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:14 Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( modified ) Completed Automata: change_size, import from State, default states Sat , 04 Dec 2010 19:51:23 GMT Ilia [19:3d1a72f49417] * Interface.py ( modified ) little corrections Sat , 04 Dec 2010 19:42:50 GMT is_rusinov [18:d2705c3ee7a7] * ...

Еще в разделе: (Показать все результаты (>229) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=749533cdfc67782471aea02a0e4a1859de8ef2bd&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&stop_rev=19%3A3d1a72f49417&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=22%3A749533cdfc67&limit=100&mode=stop_on_copy

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>50) - monkey.belozersky.msu.ru/ )

• SCOP classification
• Homeodomain numeration assumed

Diploma thesis abstract" The experimental investigation of hypersound originated by stimulated Brillouin Scattering process. ... The intensity of scattered beam was detected as a function of the coordinate z along the pumping laser beam direction, which permitted us to detect the intensity of HS as a function of z. The measurements was fulfilled for the different intensities of pump laser beam and for two different focuses lens. ...

Еще в разделе: (Показать все результаты (>23) - ofvp.phys.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>4) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>84) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/XFEL/XFEL-TDR_Chapter10_Cost-Time%20Schedule.pdf
• Альфа-распад (измерения)
• Определение расстояния между источником и детектором

EPFL application procedure and on-line application form for the incoming exchange students to EPFL during 2013/2014 is now available on our website: http://sae.epfl.ch/exchange-incoming We remind that our application procedure has to be completed online only and therefore no paper forms and documents (such as transcript of records, passport copy, CV, etc...) have to be sent to us. ... We advise them to contact your students currently on exchange at EPFL to request some help. ...

Еще в разделе: (Показать все результаты (>48) - phys.msu.ru/ )

Prague, August 16, 2006 . I am going to suggest the IAU Division V and Commission 27 a draft of a new GCVS classification scheme. ... It will also be available, after the GA, at the GCVS web site ( http://www.sai.msu.ru/groups/cluster/gcvs/ ) . We will start applying the scheme in the nearest future but are ready to take into account the future C27 suggestions, probably to be finally approved during the next GA of the IAU. ...

Еще в разделе: (Показать все результаты (>49) - sai.msu.ru/ )

... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... The first version of the nucleus of Linux operating system was written more than 20 years ago by a student, just like you, as his second-year coursework. ... Sekunov N. Programming on C++ in Linux. ...

Еще в разделе: (Показать все результаты (>10) - engineering.phys.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>98) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>83) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX
• PspoClasses/080708/01IptablesTheory - UNИX
• Meetings/Murray - UNИX

... Although the TWikiInstallationGuide is quite complete, there will on occasion be parts that don't work in your local environment (particularly with TWiki:Codev/TWikiOnWebHostingSites , which are sometimes challenging even for those with good OS and web server skills). ... The TWiki:Support web must not be depended on as a resource for this purpose - in other words, it is not there to answer basic questions about operating system and web server administration. ... TWiki:Main.GrantBow - 15 Jan 2003 . ...

Еще в разделе: (Показать все результаты (>33385) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (1 vs. 2) - TWiki
• %TOPICTITLE% (15 vs. 19) - TWiki
• %TOPICTITLE% (20 vs. 21) - TWiki

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>81) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>5) - www.issp.ac.ru/ )

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>22) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>38) - www.kosmofizika.ru/ )

This document describes how to perform update from the PC GAMESS version 7.1 build # 4471 to the PC GAMESS version 7.1.5 build # 4630 . Verify that your PC GAMESS installation is version 7.1 build # 4471. ... Note that this patch works only with the official PC GAMESS v. 7.1 build # 4471 binaries. ... After successful completion of the patch process, the PC GAMESS version 7.1.5 build # 4630 binary executable file will be written to the file pcgamess.715.exe (Windows)/ pcgamess.715 (Linux). ...

Еще в разделе: (Показать все результаты (>59) - classic.chem.msu.su/ )

• Firefly DOCUMENTATION - command line arguments
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• Firefly Home Page

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>31) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

Each Apache configuration directive is described using a common format that looks like this: . ... This indicates the format of the directive as it would appear in a configuration file. This syntax is extremely directive-specific, and is described in detail in the directive's definition. ... If the directive has a default value ( i.e. , if you omit it from your configuration entirely, the Apache Web server will behave as though you set it to a particular value), it is described here. ...

Еще в разделе: (Показать все результаты (>66) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache modules
• Apache module mod_dir