Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>5817) - istina.msu.ru/ )

• Mingaliev M.G. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Jelkmann W. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Palka N. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

EPFL application procedure and on-line application form for the incoming exchange students to EPFL during 2013/2014 is now available on our website: http://sae.epfl.ch/exchange-incoming We remind that our application procedure has to be completed online only and therefore no paper forms and documents (such as transcript of records, passport copy, CV, etc...) have to be sent to us. ... We advise them to contact your students currently on exchange at EPFL to request some help. ...

Еще в разделе: (Показать все результаты (>140) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/ac4/firstcircular.pdf
• http://phys.msu.su/rus/international/intl-collaboration-agrmnts/docs/JASSO%20scholarship%20informaiton_Tohoku2016.pdf

... MSU Chamber Orchestra . The Alia . This page contains information about the musicians who have played in our orchestra (see "members" for the current season team). Unfortunately, we have no pictures of all the people who played in the orchestra, and the available photos differ significantly in their quality. ... violini II) . ... viole) . Elena . ... violini I and II) . ... Natalia . ... violini I and II, viole) . ... celli) . ... Julia . ... violini I, viole) . ...

Еще в разделе: (Показать все результаты (>13) - music.genebee.msu.ru/ )

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>80) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• PC GAMESS/Firefly DOCUMENTATION - list of supported Linux MPI implementations
• Firefly and PC GAMESS Version History

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>21) - comphep.sinp.msu.ru/ )

• news [CompHEP]

... Payment is made at transfer of means for the University account All expenses of transferring the money to the University account are beard by the Student. In the event the Student is expelled by the University for the lack of academic progress; transgression of the sections stated in Article 3; for the Student's own personal reasons; for medical reasons confirmed by the official medical paper, all payments made are non-refundable. Article 2 Obligation and rights of the University 2.1. ...

Еще в разделе: (Показать все результаты (>27) - foroff.phys.msu.ru/ )

• Admission Regulation
• Faculty's Tuition Structure

... 34, Database issue doi:10.1093/nar/gkj102 From genomics to chemical genomics: new developments in KEGG 5 Minoru Kanehisa1,2,*, Susumu Goto1, Masahiro Hattori1, Kiyoko F. Aoki-Kinoshita1, Masumi Itoh1, Shuichi Kawashima2, Toshiaki Katayama2, Michihiro Araki2 and Mika Hirakawa1,3 1 2 Bioinformatics Center, Institute for Chemical Research, Kyoto University, Uji, Kyoto 611-0011, Japan, Human Genome Center, Institute of Medical Science, University of Tokyo, ... 34, Database issue D355 Table 1. ...

Еще в разделе: (Показать все результаты (>29908) - kodomo.fbb.msu.ru/ )

• allpy: 56bea23d3c73 lib/block.py
• allpy: 56bea23d3c73 lib/sequence.py
• allpy: 8565652a4019 lib/project.py

My colleagues and I have recently completed a series of observations of SN1999an. ... The telescope is located at Martin Observatory in Blacksburg, VA, and is operated by the Physics Department of Virginia Tech. Our IAU Minor Planet Center Observatory Code is 841. ... Attached you will find a copy of one of our images (in .jpg format) with the supernova indicated. ... Virginia Tech Department of Physics . Back to Bright Supernovae . Back to Supernova 1999an . ...

Еще в разделе: (Показать все результаты (>33) - www.rochesterastronomy.org/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search
• StructAlign help

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>1943) - www.fds-net.ru/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• DII - no realms are available right now - Public forum of MSU united student

... General Catalog of Variable Stars (GCVS database, Version 2015Sep) . ... Query forms . ... Enter The Type of the Variability : ACV ACV+ DSCT : ACV+ DSCTC ACV: ACVO ACVO: ACYG ACYG: AM AM/XRM+E AM: BCEP BCEP (B) BCEP +E BCEP +E: BCEP +EA/D BCEP + ELL : BCEP : BCEPS BE BE+ BCEP : BE: BLBOO BLLAC BY BY+UV BY+UV: BY: BY:+E: BY:+UV: CEP CEP(B) CEP: CST CST: CW CW: CWA CWA: CWB CWB: DCEP DCEP(B) DCEP: DCEPS DCEPS(B) DCEPS: DSCT DSCT (B) DSCT (B:) DSCT : DSCTC DSCTC (B) DSCTC +E DSCTC +E...

Еще в разделе: (Показать все результаты (>98) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).
• Презентация PowerPoint
• General Catalogue of Variable Stars: What's new.

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>65) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ohl/acat2002.pdf
• http://acat02.sinp.msu.ru/InfoBull2.txt
• http://acat02.sinp.msu.ru/news.html

... 12, 43 ґ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>39) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-102.pdf

... Professor Yurii Naumovich Lipsky oversaw the preparation of the first ever maps of the far side of the Moon, of the whole Moon, and cartographic globes of the Moon. ... He was a professor, a doctor of physico-mathematical sciences, the founder of the Department of Lunar and Planetary Physics in GAISh and its first head. ... The first photographs of the far side of the Moon . ... He was the scientific supervisor of the study of the first photographs of the far side of the Moon. ...

Еще в разделе: (Показать все результаты (>104) - selena.sai.msu.ru/ )

• Works of the Department of lunar and planetary research of GAISh MGU
• Morphological Catalogue Of The Craters Of Moon

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>8) - www.pereplet.ru/ )

About That Humics Joe Bloggs1, John Doe2, Juan Perez3 1Institute for Humic Materials, City, Country, JoeBloggs@humic.edu 2University of Humics, City, Country 3Academy for Humic Design, City, Country Please prepare your abstract according to this template using provided styles: AbstractTitle, AbstractAuthors, AbstractAffiliation, AbstractText, AbstractFigure, AbstractTableName. The abstract should be strictly one page including figures and tables. ... The maximum file size is 5 MB. ...

Еще в разделе: (Показать все результаты (>197) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/hit-2012/docs/abstract_template%5Bhit-2012%5D.doc
• http://www.mgumus.chem.msu.ru/publication/2007/shcherbina-reduction-2007.pdf
• Humates NATO ARW Home Page

Effective Lagrangian analysis of observed Higgs -like boson V. Bunichev Mosow State University In collaboration with E. Boos, M. Dubinin, Y. Kurihara V. Bunichev , SINP MSU QFTHEP 2013 1 Higgs -like Boson M = 125 G eV Production of Higgs -boson: Gluon fusion Vector boson fusion Assotiated production Top quark fusion V. Bunichev , SINP MSU QFTHEP 2013 2 Higgs Signals: (vbf) WW bb ZZ V ... V. Bunichev, SINP MSU QFTHEP 2013 15 ...

Еще в разделе: (Показать все результаты (>163) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/asymbrane_QFTHEP11.pdf
• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>136) - www.prof.msu.ru/ )

• A Unique Opportunity for Young Americans and Russians to Volunteer Abroad!

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>144) - uneex.mithril.cs.msu.su/ )

• Meetings/Murray - UNИX
• HelpOnXapian - UNИX

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>305) - www.philol.msu.ru/ )