... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>181) - xray.sai.msu.ru/ )

• Wolf-Rayet and He stars (stage IV)
• Константин Александрович Постнов
• Космические лучи и климат

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>134) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• D.N.Durmanov OPENING WORD

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Conditons of democratization of youth work . ... The initiative for this cooperation came from the Omsk Region Administration which had been thinking about possibilities to let young people take part at the changes of the society and to let them take part at the development of democracy in the Russian Federation. ... Last not least, the process of democratization of youth work needs trust in all actors, including children and youth, that they will find their own ways to realize democracy. ...

Еще в разделе: (Показать все результаты (>133) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Institute of Civilization

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>64) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

МГУ имени М.В.Ломоносова Русская версия . ... Public and Municipal Administration . ... Public Relations and Theory of Communication . ... The section "Public Relations and Theory of Communication" based on an educational program "Advertisement and public relations" of Philosophical Faculty of MSU. The research supervisor of an educational program the head of "Philosophy of Language and Communication" department Kostikova A.A., the associate professor , candidate of philosophical sciences. ...

Еще в разделе: (Показать все результаты (>70) - conf.msu.ru/ )

Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... UFFO . ... April 12, 2011 . The weight-dimension and thermal models of scientific equipment blocks of the spacecraft are delivered to R&D Institute of Electromechanics ? ... Discussed issues related to the flight model ofљ UFFO device. The scientific equipment systems were joined with UFFO block. ... Debugging and joining of scientific equipment with UFFO block were made. ...

Еще в разделе: (Показать все результаты (>20) - lomonosov.sinp.msu.ru/ )

... Болезни органов пищеварительной системы . ... б) с распространенным (многоуровневым поражением) проводящей системы сердца. ... Ferrer M. The rick sinus syndrome. ... Rick sinus syndrome in children with a "healthy heart". ... Buracs M., Herzkowits S., Shapiro J., Roquin N. Familial combined sinus node and atrioventricular conduction dysfunction. ... Noseda J., Reiner M., Rothlin H. Familiare bradycarde Rhyth-musstorengen: eine familie mit kranker sinus und atrioven-tricularem block. ...

Еще в разделе: (Показать все результаты (>168) - www.nature.web.ru/ )

EXPERIMENTS ON ANOMALOUS RETROACTIVE INFLUENCES IN THE CONTEXT OF THE THEORY OF GROWING BLOCK UNIVERSE Giorgio Fontana Department of Information and Communication Technology, University of Trento, 38050 Povo (TN), Italy, 39-0461 283906, fax: 39-0461 282093, giorgio.fontana@unitn.it Vladimir Polikarpov Laboratory-chair of the practical philosophy of Time , Institute of the research of the nature of ... Us ing the Wilcoxon test gave 0.301 for the neutral images, and for the affective - 0,005. ...

Еще в разделе: (Показать все результаты (>392) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/oleinik_on_the_possibility.pdf
• http://temporology.bio.msu.ru/EREPORTS/fontana_computational_universe.pdf
• Блок Р. (Block R.)

... 3 ­ Sternberg State Astronomical Institute, Moscow, :jeanna@sai.msu.ru The graphic method of the analysis of an arrangement of linear structural elements on geographical and geological maps of continents (A.V.Dolitsky, [1]) has allowed to find out global stress fields of the past and among them one which directions (the main normal and maximal tangents) describe more than 80 % of all linear elements of a relief. ... The found poles share program way on density of an arrangement on 3-4 groups. ...

Еще в разделе: (Показать все результаты (>88) - selena.sai.msu.ru/ )

• Yurii Naumovich Lipsky
• Родионова Жанна Федоровна

... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, S. Ostrouchov, and D. Sorensen, LAPACK Users' Guide, Society for Industrial and Applied Mathematics, Philadelphia, PA, second ed., 1995. ... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, and D. Sorensen, LAPACK: A portable linear algebra library for high - performance computers, Computer Science Dept. ...

Еще в разделе: (Показать все результаты (>732) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. AMTSR_P. Транспонирование матриц
• БЧА НИВЦ МГУ. SF14R_P. Эллиптические функции, интегралы и связанные с ними
• БЧА НИВЦ МГУ. SF15R_P. Эллиптические функции, интегралы и связанные с ними

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>22) - www.cie.ru/ )

• Russian Teachers Training Programmes :: Academic Programmes :: CIE
• Admissions :: CIE

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

... Research . ... Ionomer effect, polyelectrolyte gels, polyelectrolyte complexes, phase behavior of polyelectrolyte solutions. ... In this case some unusual effects originating from counterion association with ions on the gel subchains can take place. ... For counterions of intermediate size (TMA, TEA) charging of the gel causes first its swelling, then collapse and finally reswelling, when some degree of ionization is reached (polyelectrolyte - ionomer - polyelectrolyte switching). ... Kramarenko. ...

Еще в разделе: (Показать все результаты (>175) - polly.phys.msu.ru/ )

• Science
• PSMTLab - Polymer Films
• Polymer and Soft Matter Theory Lab - Official Website

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Learning and Understanding HP and 3rd party software solutions, including architectures, development practices, frameworks, methodologies, SDK's, additional programming languages and tools as necessary, etc . ... Development of test plan, unit tests, integration, system and acceptance tests, basing on functional specification and user requirements, architectures, development schedules and project plans . ...

Еще в разделе: (Показать все результаты (>139) - www.physcareer.ru/ )

• Coordinator of HP Institute of Technology for Russia CEE (Intern) / Вакансии /

You are here: Foswiki > System Web > ReferenceManual (07 Aug 2010, ProjectContributor ) (raw view) E dit A ttach . Reference Manual _Documentation for webmasters, system administrators, project managers, team leaders, and all other users of Foswiki - the Free and Open Source Wiki._ All manual sections in one big page: * [[CompleteDocumentation][Complete Documentation]] (1MB size, almost 200 printed pages) Manual sections in separate pages: 1. ... InstallationGuide][Installation Guide]] 1. ...

Еще в разделе: (Показать все результаты (>4836) - wiki.cmc.msu.ru/ )

• HistoryPlugin < System < Foswiki
• (backlinks in all Webs) CommandAndCGIScripts < System < Foswiki
• (backlinks in System Web) CommandAndCGIScripts < System < Foswiki

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>24) - nanofluidics.phys.msu.ru/ )

... A new environmental -economic policy Low environmental financing Boris Gryzlov: the ruling party on environmental problems Sociological survey of the state of environment in Russia The outcome of Rosprirodnadzor in 2010 Environmental policy in the Northwest Federal District Fundamentals of Ecological Policy of ... Environmental policy in the Northwest Federal District Heads of territorial bodies of Rosprirodnadzor in the Northwest Federal District summed up for 2010. ...

Еще в разделе: (Показать все результаты (>170) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/3_11.pdf
• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/6_11.pdf
• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/5_11.pdf

Shows a complete history of a topic. ... When using PatternSkin enabling the HistoryPlugin changes the "History" link in the bottom action bar so it opens a page with a nice user interface where you can select the versions to compare. ... If RevCommentPlugin is installed and activated the "History" page will show the comments entered for each revision. ... Default layout: a simple list of topic revisions using the default format (see below) . ... Version: . ... Foswiki::Plugins::VERSION 1.024 . ...

Еще в разделе: (Показать все результаты (>1832) - wiki.cs.msu.ru/ )

• (backlinks in System Web) CommandAndCGIScripts < System < Foswiki
• (backlinks in System Web) WebTopBarExample < System < Foswiki
• (backlinks in System Web) DevelopingPlugins < System < Foswiki