Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with J? urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + Ї Ї Ї + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>137) - higeom.math.msu.su/ )

• Publications (English)
• C*-algebras: Talks
• Publications of E.A.Morosova

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>520) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: American Association of University Woman
• Клуб выпускников МГУ: Обсуждение материала "American Association of University
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>217) - www.kosmofizika.ru/ )

May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...

Еще в разделе: (Показать все результаты (>4) - dbserv.sinp.msu.ru/ )

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>167) - www.mmonline.ru/ )

• MMOnline | Форумы | Первокурсникам | Си - полезная информация

... There are two methods of describing plant associations of the lake-shore: visual and analytical. ... We analyzed each lake separately with help of cluster analysis (Manchattan distance, Ward method). ... Besides, cluster analysis only for common plant species was performed. ... All common species on this lake form one multitudinous cluster (fig. 5), except for Comarum palustre and Equisetum fluviatile (the same group of species reveled by cluster analysis for common species from other lakes). ...

Еще в разделе: (Показать все результаты (>158) - herba.msu.ru/ )

• Systema Naturae
• Flowers: Diversity, Development and Evolution
• Publications about flora

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>144) - uneex.mithril.cs.msu.su/ )

• HelpOnXapian - UNИX
• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX
• PspoClasses/080708/01IptablesTheory - UNИX

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>14) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• install [CompHEP]

... General information . Instrument . ... Device . The NUCLEON scientific module consist of: . The NUCLEON device as the monoblock in the own pressurized container; . ... Concept of device . A main idea of this project - to develop the method and to design a scientific instrument with large aperture being able to measure elemental spectra of cosmic rays in a wide energy range 10 12 -10 15 eV with the high charge resolution. ... The general NUCLEON module characteristics are: . ...

Еще в разделе: (Показать все результаты (>18) - smdc.sinp.msu.ru/ )

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Еще в разделе: (Показать все результаты (>65) - chaos.phys.msu.ru/ )