Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Education . People . ... TWiki ? ... TWikiTip017 . TWiki has "Soft security" - anyone can change anything, but changes are logged. ... Person who made change is recorded. At the footer of each topic one can click on previous versions. ... Changes . ... Copyright by the contributing authors. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiTip017 . ...

Еще в разделе: (Показать все результаты (>35913) - dualopt1.cmm.msu.ru/ )

• TWikiTip017 - TWiki - TWiki - (printable)
• %TOPICTITLE% (15 vs. 19) - TWiki
• %TOPICTITLE% (3 vs. 4) - TWiki

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

... J. 11 (3): 287290 ї RUSSIAN ENTOMOLOGICAL JOURNAL, 2002 Succession in a insects community inhabiting horse dung Сукцессии в сообществе насекомых, населяющих помет лошадей A. M. Psarev А. М. Псарев Department of Invertebrate Zoology, Faculty of Biology and Soil Sciences, Tomsk State University, Lenin av. ... When comparing succession in horse dung with the similar processes in cow dung some differences in the species composition and in rate of these changes can be clearly seen. ... Copromyza spp.) ...

Еще в разделе: (Показать все результаты (>1295) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Contribution to age determination of pikas (Lagomorpha, Ochotonidae, Ochotona).
• Biochemical analysis of the metabolism of small rodents living in different

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>12) - bioinf.fbb.msu.ru/ )

• SDPpred

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>4) - compmech.math.msu.su/ )

• О кафедре - Кафедра вычислительной механики

Title Author Key words Value orientations and socio-political participation of Russians Trophimova I. N. values, social and political participation, state power, society The article discusses the features of value orientations and practices of social and political participation of the Russians. ... The basic Abstract contradiction affecting the specifics of social and political participation in the Russian society is formulated. ...

Еще в разделе: (Показать все результаты (>55) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/11.pdf

... We study the effect of modification free SH-groups level of superficial proteins (pHMB affect), mild proteolysis of the superficial nerve proteins (pronase ) and sorption on the nerve alien protein OspA (isolated from Borrelia burgdorferi sensu stricto) on the axon-Shwann cell interactions. ... Aplying Raman spectroscopy we have showed the decrease in the axolemma microviscosity (AM) during binding of free SH-groups and sorbtion of OspA, and the increase in AM under the nerve proteins proteolysis. ...

Еще в разделе: (Показать все результаты (>97) - www.msm.biophys.msu.ru/ )

• MSM 2007

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>93) - td.chem.msu.ru/ )

• PhD Defence Laboratory of Chemical Thermodynamics
• Carbamide Laboratory of Chemical Thermodynamics
• CpAppro Laboratory of Chemical Thermodynamics

Общее . ... Геология в Московском университете . ... Профком геологического факультета . ... Геологический факультет МГУ всемирно известный учебно-научный центр России. ... Вся деятельность сотрудников факультета направлена на развитие геологической науки, образования и культуры необходимых условий экономического и духовного возрождения России. ... 119991, Российская Федерация, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Геологический факультет, . ...

Еще в разделе: (Показать все результаты (>4) - geol.msu.ru/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>79) - uneex.mithril.cs.msu.su/ )

• Meetings/Murray - UNИX

... Физика атомного ядра и частиц" . Физика ядра и частиц. ... Программа курса "Физика ядра и частиц " . ... Семинары по физике ядра и частиц . ... Мир атомных ядер . ... 12 лекций по физике атомного ядра . ... Атомные ядра. ... Физика атомного ядра и частиц в УФН . ... Физика атомного ядра и частиц в Физической энциклопедии . ... Мы были бы признательны за ваши замечания и предложения, особенно признательны тем, кто согласится сотрудничать в подготовке материалов по физике частиц и атомного ядра. ...

Еще в разделе: (Показать все результаты (>188) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>151) - www.fadr.msu.ru/ )

• THE ALBANIAN AGRICULTURAL SECTOR IN TRANSITION
• Foundation for Agrarian Development Research - Team
• An International Consensus on Calcareous Paleosol Classification

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

The emergence of life based on amino acid and RNA/ DNA on an Earth type planet requiers a quite narrow parameter space of many of the planet's physical parameters, most important are its mass and temperature conditions. ... The period, more or less, is conserved for the giant planets.) ... Thus, the mass of a terrestrial planet suitable for the advent of the LANA should be close to 5*10 27 g. The same value follows from quite a different condition: the planetary atmosphere should be retained. ...

Еще в разделе: (Показать все результаты (>210) - lnfm1.sai.msu.ru/ )

• Celestial Mechanics
• Natural Satellites Data Center. Objectiv.
• Отдел небесной механики ГАИШ

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>10) - www.sciencepark.ru/ )

... It was found that CNT-based filters are efficient for the adsorption of heavy metals from aqueous solution. DETERMINATION OF THE NI (Tl) DETECTOR EFFICIENCY USING RADIOACTIVE PARALLELEPIPED SOURCES Mohamed S. Badawi1), Mona M. Gouda1), Ahmed M. El-Khatib1), Mohamed A. Elzaher2), Abouzeid A. Thabet3), Ahmed A. Salim1) and Mahmoud I. Abbas1) 1) Physics Department , Faculty of Science, Alexandria University , 21511 Alexandria, Egypt , 2) Department of Basic and Applied Sciences, ...

Еще в разделе: (Показать все результаты (>101) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/Mashkova_NIMB2011InPress-Grafit.pdf
• http://danp.sinp.msu.ru/LIIWM/Nimb230_05_443Mashkova.pdf
• http://danp.sinp.msu.ru/LAS/Nimb256_07_21Teplova.pdf

... The delayed fluorescence of chlorophyll (DF) is an informative characteristic of the backward electron transfer in the reaction centers (RC) as well as of the functional activity of the photosynthetic apparatus (PSA) in vivo and in vitro under various physical and chemical factors (Hauvax, Lannoye, 1985; Rubin et al., ... Predominant bleaching of the long-wavelength fraction of chlorophyll provides evidence that oxidative reactions are located close to the reaction center of PSI. ...

Еще в разделе: (Показать все результаты (>12) - biophys.msu.ru/ )

• Stress of plant cells

Below is a list of all of the modules that come as part of the Apache distribution. ... mod_actions Apache 1.1 and up . ... Sending files which contain their own HTTP headers . ... User authentication using text files . ... User authentication using Berkeley DB files . ... User authentication using DBM files . ... mod_browser Apache 1.2.* only . ... Replaced by mod_setenvif in Apache 1.3 and up . ... Logging of User Agents . ... Replaced by the mod_log_config module in Apache 1.2 and up . ...

Еще в разделе: (Показать все результаты (>75) - neptun.sai.msu.ru/ )

• Stopping and Restarting Apache
• Anatoly V. Zasov
• Definitions of terms used to describe Apache directives

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>51) - pont2008.cmc.msu.ru/ )

• On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) International
• Optimal Control and Differential Games. Poster session Международная

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>377) - www.philol.msu.ru/ )

• Кафедра РКИ для гуманитарных факультетов
• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html
• Кафедра русского устного народного творчества