... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>84) - www.msm.biophys.msu.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>11) - theorphys.phys.msu.ru/ )

• Сарданашвили Геннадий Александрович

... Berezhnoy A.A., Kozlova E.A., Shevchenko V.V. Sternberg State Astronomical Institute, Moscow University, Russia, Moscow, Universitetski pr., 13, 199992. katk@sai.msu.ru According to the data from "Lunar Prospector" [1] the areas of high hydrogen content in the lunar south pole region coincide with the areas of such craters as Faustini (87.2є S, 75.8є E), Cabeus (85.2є S, 323є E) and other crates. ... We estimate the total permanently shadowed area in the lunar northern polar region at 28 260,2 km2. ...

Еще в разделе: (Показать все результаты (>94) - selena.sai.msu.ru/ )

• Yurii Naumovich Lipsky

Image enhancement quality metrics Andrey Nasonov, Andrey Krylov Laboratory of Mathematics Methods of Image Processing Department of Computational Mathematics and Cybernetics Moscow State University, Moscow, Russia {nasonov, kryl}@cs.msu.ru Abstract The paper presents a new adaptive full reference metrics for the quality measurement of image enhancement algorithms. ... Two types of artifacts are considered: blur and ringing effect. ... BASIC EDGES Blur and ringing effect appears near sharp edges. ...

Еще в разделе: (Показать все результаты (>134) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2000.NFAO.Krylov.en.pdf
• http://imaging.cs.msu.ru/pub/2011.ITSF.Krylov_Mizotin.Laguerre.en.pdf

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>436) - xray.sai.msu.ru/ )

• Nomenclature
• State of the problem
• The Model

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

Еще в разделе: (Показать все результаты (>4) - lab110.imec.msu.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>283) - www.philol.msu.ru/ )

e-mail: viverhovin@yandex.ru ) , , , , , hyperinflation in Germany, inflationary expectations of the population, inflationary shock, liquidity schedule in conditions of hyperinflation, consequences of hyperinflation, social polarization in conditions of hyperinflation , 20 - . Models and stereotypes of economic behavior in conditions of the hyperinflation which has shaken Germany in 1920th years are considered in this article. ...

Еще в разделе: (Показать все результаты (>75) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2012/3/11.pdf

... General ideas of classical game-theoretic analysis: Game in normal form (as a model of players interaction) -Several participants (players) - Several possible strategies for each player -Payoff functions Principle of Nash equilibrium (as a method to define agents strategies during their interaction) -Nash equilibrium is a basic concept of game theory. ... If is not an equilibrium then mutants with pure strategy that is a best reply to have grater payoff than the average payoff for the main...

Еще в разделе: (Показать все результаты (>15) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

PRL 105, 010404 (2010) PHYSICAL REVIEW LET TE RS week ending 2 JULY 2010 Statistical Estimation of the Efficiency of Quantum State Tomography Protocols Yu. ... It is based on a priori estimation of the quality of an arbitrary protocol by means of universal asymptotic fidelity distribution and condition number, which takes minimal value for better protocol. ... The present approach allows to analyze arbitrary protocols of statistical reconstruction of quantum states. ... 1] M. Genovese, Phys. Rep. ...

Еще в разделе: (Показать все результаты (>76) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• http://qi.phys.msu.su/papers/2007-os(e)-103-107.pdf
• http://qi.phys.msu.ru/papers/2010-jetp(e)-110-185.pdf

Exchanges Exchanges with Moscow University . ... Exchanges . ... Students studying at partner universities may come as exchange students to Moscow University according to conditions set up by exchange agreements. ... Formal nomination letter signed by head of international office of home university. This letter shoull arrive in original and by fax to +7 (495) 9328960 or as scanned copy to e-mail of a proper coordinator . Personal application , also as original and by fax/e-mail. ...

Еще в разделе: (Показать все результаты (>3) - www.ied.msu.ru/ )

• International Office of Moscow University - Exchanges

Title Author Key words Suicides in the United Kingdom (1981­2011): dynamics, trends, especially S.V. Bogdanov, J.S. Bogdanova suicide, UK, men, women, age groups The dynamics completed suicides in the UK over the years 1981­2011. Discusses the distribution of suicides by sex, age. The geographical distribution of suicide mortality of the UK population by region. Abstract

Еще в разделе: (Показать все результаты (>79) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/03.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/2/08.pdf
• Вестник МГУ

... School problem is extremely important. ... Our President has mentioned the territorial disparity, i.e. two-thirds of our schools are the rural schools and their graduates are at unequal terms with their equals from cities' schools to get following education. ... Create special conditions in education for disabled children, for orphans and children from unfortunate families, pupils from rural schools and gifted children. ... Ensure social equity for all children during school education and after it. ...

Еще в разделе: (Показать все результаты (>36) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/273.doc
• http://www.rsr-online.ru/doc/norm/327.doc
• http://www.rsr-online.ru/doc/norm/243.doc

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>13) - hcs.cmc.msu.ru/ )

• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>644) - swx.sinp.msu.ru/ )

• SWX - Космическая погода

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>32) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2011_1_eng.pdf
• Summaries of articles
• V.Zakharov's Ph.D. thesis

... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...

Еще в разделе: (Показать все результаты (>13) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%201.pdf

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>89) - www.mgubs.ru/ )