... 2008 2009 2010 2011 2012 2013 2014 2015 2016 . ... Контакты Обратная связь Карта сайта Часто задаваемые вопросы (F.A.Q.) . ...

Еще в разделе: (Показать все результаты (>37) - new.math.msu.su/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

... V.V. Busarev, Sternberg State Astronomical Institute, Moscow University, . ... V. V. Busarev1, M. N. Taran2, V. I. Fel’dman3 and V. S. Rusakov41 Lunar and Planetary Department, Sternberg State Astronomical Institute, Moscow State University, 119992 Moscow, Universitetskij pr., ... 1 Sternberg State Astronomical Institute, Moscow University, Universitetskij pr., ... V. V. BUSAREV, Sternberg State Astronomical Institute, Moscow University, Russian Federation (RF) (E-mail: busarev@sai.msu.ru); . ...

Еще в разделе: (Показать все результаты (>92) - selena.sai.msu.ru/ )

• My trip to the conference “Near-Earth Astronomy -2003”, Terskol
• Yurii Naumovich Lipsky

... Conference organizers: . Institute for the Study of Terrorism University of Information Technology and Management in Rzeszow . ... The University of Information Technology and Management welcomes academic experts and practitioners from different countries who are interested in presentation of their research findings on the theme Systems and institutions to combat terrorism in Poland and abroad for the 2016 conference. ... State and civil institutions in combating terrorism; . ... Prof., PhD . ...

Еще в разделе: (Показать все результаты (>198) - ee-journal.spa.msu.ru/ )

... Master Education . Second Education . ... Entrance requirements . ... personal statement addressed to the rector of MSU, containing the post-graduate course title and masters? program name . ... All applicants for full-time course (Russian students, both on scholarship and contract) are subject to following examinations: . ... All applicants to evening courses take an oral examination in the field of expertise. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>130) - hcs.cmc.msu.ru/ )

• Conferences | Магистерское и послевузовское образование
• Mathematical models and methods in VLSI design | Магистерское и послевузовское

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>100) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>380) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... On a Classification of Orbits for Cubic Differential Systems . M.Popa, E.Naidenova (Academy of Sciences, Institute of Mathematics and Computer Sciences, Kishinev, Moldova) . ... We consider a two-dimensional system of differential equations of the first order with polynomial right . ... Using the methods described in [1] the complete classification of orbits for linear representation of the group of rotations and Lorentz group in the space of coefficients of the cubic differential system is done. ...

Еще в разделе: (Показать все результаты (>80) - acs366.phys.msu.su/ )

• General Information
• ISNA-16

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>141) - ffl.msu.ru/ )

International Symposium "Erosion and sediment yields in the changing environment" OCT. 11-15 2012 CHENGDU, CHINA International Symposium of IAHS-ICCE in 2012 CHENGDU, CHINA OCT. 11-152012 SYMPOSIUM THEME "Erosion and sediment yields in the changing environment" International Symposium "Erosion and sediment yields in the changing environment" OCT. 11-15 2012 CHENGDU, CHINA 1. ... Electronic files of International Symposium "Erosion and sediment yields in the changing environment" OCT. ...

Еще в разделе: (Показать все результаты (>68) - eng.geogr.msu.ru/ )

• International conference «Bringing together Selenga-Baikal research”
• Conferences
• International cooperation

miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...

Еще в разделе: (Показать все результаты (>29) - www.anthropos.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Outreach . ... TEPA?2012 was held at Lomonosov Moscow State University, Russia. ... Workshop on ?Lomonosov? project held in Moscow State University, November, 28-30, 2011 . ... Current state of the project as a whole. ... Space vehicle status. ... Universitetsly-Tatiana-2?, and the space project ?Chibis?, being developed by Space Research Institute of RAS (IKI RAS) in collaboration with Moscow State University. ...

Еще в разделе: (Показать все результаты (>24) - lomonosov.sinp.msu.ru/ )

... HOMETOPIC%][%HOMETOPIC%]] - try out Foswiki on your own * [[Sandbox.% TOPIC%Sandbox][%TOPIC%Sandbox]] - just for me * * ---++ My Personal Data Note: if personal data is being stored using a secret database, then it is only visible to the user and to administrators. ... My Personal Preferences Uncomment [[%SYSTEMWEB%.PreferenceSettings][preference settings]] to activate them (remove the #-sign). ... This topic: Main > WikiUsers > ArtemTimoshenko . ... Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>1598) - wiki.cs.msu.ru/ )

• HistoryPlugin < System < Foswiki
• (backlinks in System Web) CommandAndCGIScripts < System < Foswiki
• (backlinks in System Web) WebTopBarExample < System < Foswiki

The IV International Conference "Cosmology. ... Cosmoparticle physics" (COSMION-99) in the Honor of 80-th Birthday of Isaak M. Khalatnikov is organized by the Center for Cosmoparticle Physics "Cosmion" and Landau Institute for Theoretical Physics in the period October 18-24, 1999 to consider the prospects of development of cosmology, relativistic astrophysics and cosmoparticle physics in Russia. ... The place of meetings is sanatorii RAS "Uzkoe" (Profsoyuznaya str. 123a) . ...

Еще в разделе: (Показать все результаты (>430) - xray.sai.msu.ru/ )

• List of Conferences
• Giazotto
• Cosmion-2001

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>100) - uneex.mithril.cs.msu.su/ )

• Conferences/Pereslavl2009 - UNИX
• Conferences/Pereslavl2012 - UNИX
• Conferences/WinterSchool2010 - UNИX

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>299) - uneex.lorien.cs.msu.su/ )

• perchild - Apache HTTP Server
• Conferences/Pereslavl2009 - UNИX
• Conferences/Pereslavl2006 - UNИX

... Moscow, Russia . ... Moscow State University (MSU), Department of Physics, . ... Analysis features of block copolymer thin films by atomic-force microscopy ? ... Courses of English Language, Moscow State University . ... Researcher, Laboratory of Scanning Probe Microscopy , Department of Physics, Moscow State University (MSU) . ... Bolshakova A.V., Yaminsky I.V. Analysis of block-copolymer films structure by atomic force microscopy // Moscow University Physics Bulletin, 2009, No 2 (in press) . ...

Еще в разделе: (Показать все результаты (>78) - www.spm.genebee.msu.ru/ )

• Alexander S. Filonov Professional Publications
• Alexey Dobrynin - personal web page
• Bagrov Dmitry

... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov љis organized by the Steklov Mathematical Institute andљFaculty of Computational Mathematics and Cybernetics of Moscow State University fromљ12 to 14 of February, 2015 and will take place at the Faculty of Computational Mathematics and Cybernetics of Moscow State University .љ ...

Еще в разделе: (Показать все результаты (>5) - smu.cmc.msu.ru/ )

• XXIII конференция Ломоносов (11-15 апреля 2016г.) | Совет молодых ученых ВМК...

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Articles . ... S.V. Balakhonov, B.R. Churagulov . ... Yu.V. Kolen'ko, A.A. Burukhin, B.R. Churagulov and N.N. Oleinikov . ... Burukhin A.A., Oleynikov N.N., Churagulov B.R., Demazeau G., Solozhenko V.L., Kolen'ko Yu.V. "Synthesis of nanocrystalline zirconia powders from hydrothermal and supercritical solutions" . ... Burukhin A.A., Churagulov B.R., Oleynikov N.N., Kolen'ko Yu.V. "Synthesis of Nanostructured Iron Oxide(III) Powders by Rapid Expansion of Supercritical Fluid Solutions" . ...

Еще в разделе: (Показать все результаты (>44) - www.inorg.chem.msu.ru/ )

• Группа гидротермального синтеза :: Публикации
• Joint Semiconductors Surface Study group