Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...

Еще в разделе: (Показать все результаты (>16) - suny.msu.ru/ )

... IMPACT: New carbon-based materials with exceptional chemical and physical properties . ... AREA: Condensed Matter Physics, Physical Chemistry, Structure and Dynamics of Atomic-Molecular Systems, Engineering Sciences and Mechanical Engineering . ... Moscow State Uiversity . ... STRATEGY: Application of ab initio methods for simulation of forbidden reflections energy spectra taking into account thermal displacements of atoms and protons fluctuations. ... AREA: Condensed Matter Physics . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Mechanics | Moscow University Supercomputing Center
• Supercomputing Education Project | Moscow University Supercomputing Center
• GPU Center of Excellence | Moscow University Supercomputing Center

... Дайджест психологических исследований . ... применение тестов математические методы в психологии анализ и визуализация данных результаты выборов математические методы наука юмор организационная психология диссертация hr выборы диссертации эксперименты геолокация опросы ссылки профессии мотивация психодиагностика MS Excel онлайн-сервисы SEM ubuntu психологические журналы R IBM SPSS Statistics фото SPSS рецензии онлайн исследования структурное моделирование анализ данных регрессионный ...

Еще в разделе: (Показать все результаты (>171) - tukachev.flogiston.ru/ )

• Tag: SPSS Evaluation Version
• Tag: SEM
• Likert-Type Scale Response Anchors

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>128) - www.mgubs.ru/ )

• The Ljubljana Summer school
• Высшая школа бизнеса МГУ им. Ломоносова

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Еще в разделе: (Показать все результаты (>28) - imk.msu.ru/ )

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>5) - sparallel.ru/ )

• sparallel.ru - Part 106

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>182) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/Qfthep_mTCA_PVolkov.pdf
• http://qfthep.sinp.msu.ru/talks2013/fcnc_presentation.pdf
• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf

... More Reports . ... Defence calls reflect levels of discomfort in the pallid gerbil ( Gerbillus perpallidus ) // Advances in Ethology. Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ... In contrast, winners never called. ... We assumed that a shortening of the distance between combatants reflected an increase of discomfort for the loser (caller), whereas an increased distance reflected decreased discomfort. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>630) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях
• Department of Vertebrate Zoology
• Leaders of the Department

... You have to choose only one answer among the suggested options; for tasks 1-4 write down `agree' beside the answer you choose. ... Peptide bond between amino acids in a molecule of protein is underlaid by: a) b) c) d) the principle of complementarity; insolubility of amino ac ids in water; solubility of amino acids in water; the presence of carboxy and amino group; Task 2. ... There are ten cards, each with one side white and one side black. ... What is your understanding of the word "progress"? ...

Еще в разделе: (Показать все результаты (>176) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/people/krivitsky/krivitsky2007.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/nazarov.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_31-40.pdf

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>6) - swx.sinp.msu.ru/ )

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>147) - ffl.msu.ru/ )

• http://www.ffl.msu.ru/students/courses/fl-teaching/2-basova-general-english-2-lmkk-year.pdf
• About Us

Laboratory of Systems for Automated Image Processing . ... Development of efficient methods for solving inverse problems of x-ray and wave tomography . ... Wave Tomography . ... The methods of solving inverse problems as coefficient inverse problems can provide information about the internal structure of the object even in the case of limited data tomography. ... One of the main challenges faced by ultrasonic tomography is the development of mathematical methods for solving inverse problems. ...

Еще в разделе: (Показать все результаты (>157) - srcc.msu.ru/ )

• Tatiana V. Amotchkina, Michael K. Trubetskov, Vladimir Pervak, Boris Romanov,
• Laboratory of Informatics

... Описание вакансии: . The Famous FMCG Company (Top-3) looks for Standards Office Manager in R Department . ... Create and register R and Regulatory documentation . ... Manage update of documentation in valid forms. Daily tracking of documentation validity and make changes in proper time to ensure the correct and on time activity of commercial production. ... Fluent English and excellent computer skills, skills to work with the databases . High skills to work with people; teamwork skills . ...

Еще в разделе: (Показать все результаты (>47) - www.chemport.ru/ )

• "Head of chemistry" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

English version] [Pyc.- ... The laboratory was founded in 1991, when Cellulase Research Group at the Division of Chemical Enzymology, M.V.Lomonosov Moscow State University, received the status of laboratory. From the moment of establishment of the Division of Chemical Enzymology in 1974 by Professor Ilya Berezin, Cellulase Research Group was led by Dr. Anatole Klyosov. ... Enzymology, biochemistry and biotechnology of enzymes catalyzing the biodegradation of polysaccharides: . ...

Еще в разделе: (Показать все результаты (>163) - www.enzyme.chem.msu.ru/ )

• Cellulase lab Russian version
• Entrez-PubMed
• PubMed medline query

... BBK 22.6 G 12 UDK 37:[52+53] (076.1) G 12 Gavrilov M.G. / Zviozdnyj Mir: Sbornik zadach po astronomii i kosmicheskoj fizike. ... Here is volume IV – problems of the Olympiads of Scientific Centre in Chernogolovka (former Noginsk Scientific Centre). ... Russian introduction INTRODUCTION Olympiad for high schools students is one of interes- ting traditions of Chernogolovka: a small picturesque villa- ge not far from Moscow, in which the Scientific Center of the Russian Academy of Sciences is situated....

Еще в разделе: (Показать все результаты (>17) - www.issp.ac.ru/ )

• Chernogolovka
• Comet Observation Home Page (Chernogolovka)
• Institutes of Chernogolovka

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Еще в разделе: (Показать все результаты (>4) - quantum.phys.msu.ru/ )

... Publications . Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Preliminary image registration for creation of virtual models of real objects . Publication type . Conference paper . ... Publication date . 2007 . Conference . 2007 International Conference on Cyberworlds . ... BookTitle = {2007 International Conference on Cyberworlds}, . Year = {2007}, . ...

Еще в разделе: (Показать все результаты (>563) - imaging.cmc.msu.ru/ )

• Laboratory of Mathematical Methods of Image Processing
• Ringing analysis - database | Laboratory of Mathematical Methods of Image
• Ringing effect modeling | Laboratory of Mathematical Methods of Image...

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>9) - www.rlcentre.com/ )

• "ABOUT RUSSIAN" - news about Russian language and Russia