Эталонное тестирование окружающей среды самых больших ТЭС на твердом топливе в США. ... С. 182-192. ... Хотя эффективное управление этих типов ТЭС критическое к локальным, национальным и глобальным проблемам окружающей среды, немногие исследования сосредоточены на измерении эффективности и совершенствовании эффективности энергетики. ... При использовании многокритериальной непараметрической производственной модели (охватывающей данные анализа) определено множество протоколов эффективности. ...

Еще в разделе: (Показать все результаты (>7) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207000102

... Полная версия: Поколение 70х . Грация-МГУ::Форум > Общение > Литература . ... Мая 25 2007, 01:57 . Поскольку на форуме есть люди, которые любят читать литературу на языке оригинала, предлагаю вашему вниманию справочник молодежного сленга тех годов. http://www.inthe70s.com/generated/terms.shtml . Вверху страницы есть также ссылки на 80е и 90е года. ... Это текстовая версия - только основной контент. Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда . ...

Еще в разделе: (Показать все результаты (>12) - grace.msu.ru/ )

• Поколение 70х - Грация-МГУ::Форум

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

• Solar Physics Department

... 2, JUNE 2007 1185 Commissioning of the CMS Magnet Domenico Campi, Benoit CurИ, Andrea Gaddi, Hubert Gerwig, Alain HervИ, Vyacheslav Klyukhin, Gilles Maire, Goran Perinic, Philippe BrИdy, Philippe Fazilleau, Francois Kircher, Bruno LevИsy, Pasquale Fabbricatore, Stefania Farinon, and Michela Greco Abstract--CMS (Compact Muon Solenoid) is one of the large experiments for the LHC at CERN. ... The construction of the CMS Magnet, and of the coil in particular, has been completed last year. ...

Еще в разделе: (Показать все результаты (>36) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/zhigareva_23-04-13.pdf
• http://lav01.sinp.msu.ru/nir/papers/IEEE_TNS_51_5_2004_2187-2192.pdf
• http://lav01.sinp.msu.ru/nir/papers/PRD72001.pdf

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>6) - srd.sinp.msu.ru/ )

Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...

Еще в разделе: (Показать все результаты (>52) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf

... Lomonosov Moscow State Univ Research Center "Computer Science and Control" of RAS (FRC CSC RAS) Operations Research Society (RSORS) will organize the VIII Conference in Octo Operations Research. theoretical aspects and ersity (MSU), Federal and Russian Scientific ber 2016 in Moscow. ... Deadline for abstract submissions is March 31, 2016. ... Conference website: http://io.cs.msu.ru/ORM2016.html. ... Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>11) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2016/ORM2016-2nd_announ-ENG.pdf
• http://io.cs.msu.ru/translation2.pdf

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>22) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/gorgidze98.pdf
• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf
• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>4) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf

Unfaithful embedding of causal sets arXiv:1006.2320v1 [physics.gen-ph] 10 Jun 2010 Alexey L. Krugly Abstract In the causal set approach, spacetime is a continuous approximation of a faithful emb edded causal set. But the faithful emb edded causal set describ es the empty spacetime and cannot describ e matter. ... If we describe the elements of the faithfully embedded causal set as the vertices of the graph, and segments of the timelike curves as edges these vertices must have an infinite valency. ...

Еще в разделе: (Показать все результаты (>14) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_discrete-sequential.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_a-sequential-growth.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_the-dinamics.pdf

January 10, 1997 NeuroMotion Case Study The Problem 2 The Products 3 The Company 4 Beginnings 4 NeuroMotion is formed 5 Company structure 6 NeuroMotion ownership 6 Funding structure 7 NeuroMotion personnel 9 The Issues 10 Clinical trials 10 Evaluating the products 10 Consultants 12 Intellectual property 12 Marketing and sales 13 Distribution 15 Finances 16 The Next Step 17 APPENDIX A: NeuroMotion Products 18 APPENDIX B: Competing ... Product |957 |1,602 |1,451 |1,213 |1,213 | ...

Еще в разделе: (Показать все результаты (>17) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/venturecapital.doc
• http://www.innovation.msu.ru/english/settingupapaysystem.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... Variables representing the environmental conditions were `food' and `infection'. ... APPENDIX 1 An example of optimal life -history traits values (for a = 1.7 and m = 0.9) t 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ... 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z Et 2.3 2.5 2.7 2.8 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.8 3.9 4.0 4.0 4.1 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 ...

Еще в разделе: (Показать все результаты (>21) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1999_Seasons_EER.pdf

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>4) - asa.guru.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

157. http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:bunina_proofs.pdf

158. http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf

159. EDAS2 - Alternative Splicing DataBase.

160. Welcome to nginx!