... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Physics ? Uspekhi 58 (12) 1220 ? 1222 (2015) LETTERS TO THE EDITORS #2015 Uspekhi Fizicheskikh Nauk, Russian Academy of Sciences PACS numbers: 05.45. ? a, 45.40. ? f Notes on new friction models and nonholonomic mechanics A V Borisov, I S Mamaev DOI: 10.3367/UFNe.0185.201512g.1339 Abstract. ... Using recent results as examples, it is shown that the validity and potential of the nonholonomic model are not inferior to those of other dynamics and friction models. ... 226 2831 (2015) Borisov A et al. ...

Еще в разделе: (Показать все результаты (>137) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/76b/2524.pdf
• http://ics.org.ru/upload/iblock/b91/131-on-the-integration-theory-of-equations-of-nonholonomic-mechanics_ru.pdf
• Institute of Computer Sciences - Publications

... Plenary talk by Yu.G. Evtushenko (CCAS RAS) "Effective methods for solving of large-scale optimization problems" Chair I.G. Pospelov : .. ... Plenary talk by V.V. Podinovsky (NRU HSE) "Criteria importance theory: state-of-the-art" Chair A.V. Lotov : . ... Plenary talk by Yu.V. Dorn, A.V. Gasnikov*, Yu.E. Nesterov, S.V. Shpirko "The Three-Stage Version of Stable Dynamic Model" Chair Yu.E. Nesterov 355 113 2 2 2 2 2 ( ) 10:00 11:00 11:30 14:00 15:15 18:00 ? ? (, , 17 , , 526) 11:10-13:50, .. ...

Еще в разделе: (Показать все результаты (>9) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/translation2.pdf

European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://www.msu.ru/int/newpr/7ram/7ram_napr.pdf
• http://ideas.msu.ru/docs/Decision_ideas.pdf
• http://ideas.msu.ru/docs/Work_programme_2011.pdf

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... 2000 June 21 . Solstice Celebration . ... Each individual image highlights a different temperature regime in the upper solar atmosphere and was assigned a specific color; red at 2 million, green at 1.5 million, and blue at 1 million degrees C. The combined image shows bright active regions strewn across the solar disk, which would otherwise appear as dark groups of sunspots in visible light images, along with some magnificent plasma loops and an immense prominence at the righthand solar limb. ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: 2000 May 7 - A Green Flash from the Sun
• APOD: 2000 July 13 - LP 944-20: A Failed Star Flares
• APOD: April 9, 1999 - WR 104: Pinwheel Star

... Data . ... MIR Station . ... Mir was the world's first consistently inhabited long-term research station in space, and the first 'third generation' type space station, constructed over a number of years with a modular design. ... Detectors of the instrument package allow observing fluxes of >0.1 MeV gamma-quants associated with bremstrahlung emission of high energy electrons of similar energies and with integral fluxes of high energy electrons (>5 MeV) and protons (>60 MeV). ... 60 MeV). ...

Еще в разделе: (Показать все результаты (>24) - smdc.sinp.msu.ru/ )

• Cosmos-1686 - Space monitoring data center
• Coronas-I - Space monitoring data center

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... All Journals . This list contains all journals in JCatalog database. Select the letter and click it. If there is no action when clicking then no journals begins from this letter. Set the mouse cursor on any letter and you will know the number of journals; gray letter colour means that no journals begins from it. ... View whole journal list(1749) . ... Index | All journals . ...

Еще в разделе: (Показать все результаты (>62) - journals.genebee.msu.ru/ )

• Different alphabetic indexes of JCatalog

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . ... The studies of Lomonosov determined profile of Russian science forever, and we appreciate the discoveries of the leading Russian scientists as the studies of his direct learners and successors. A recognized and the most significant input of Lomonosov into natural science is molecular-kinetic theory of heat, developed during the prevalence of theory of specific fiery matter ? ... Lomonosov?s theory drawn wide response in European science. ... Aurora. ...

Еще в разделе: (Показать все результаты (>28) - lomonosov.sinp.msu.ru/ )

• Scientific goals | Университетский спутник "Ломоносов"

Q: Recently I read a book called ?C14-Crash? by Christian Bloess and Hans-Ulrich Niemitz (there is a summary in German with figures on . ... Briefly, the authors claim that the majority of the original assumptions made by Libby for the radiocarbon . ... directly calculated from a C14 value." ... such fractions are used for calibrations and dating. ... used for radiocarbon calibration. ... important after atmosphere reservoir - upper ocean. ... radiocarbon content in the atmosphere. ...

Еще в разделе: (Показать все результаты (>85) - hbar.phys.msu.ru/ )

• newtrev2.htm
• The jump of the second derivative of the moon's elongation

... in contrast to smth -showing a difference between people, ideas, situations, things etc that are being compared to a lesser extent-used to say how true smth is or how great or small an effect or change is globally-affecting or including the whole world overall-considering or including everything on the whole anyway-admitting that what was said before doesn't matter, this is the main point but-used to connect two statements or phrases when the second one adds ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/dictionary.pdf
• http://www.eng.math.msu.su/download/last_year_theses_by_A_Rakitko.pdf
• http://www.eng.math.msu.su/download/business_english2.pdf

Sp ecific features of differential motions in the DIMM V. Kornilov, B. Safonov May 28, 2010 1 Intro duction Differential image motion monitor DIMM widely used in studies of optical turbulence, is destined to measure the integrated effect of the Earth's atmosphere on the image quality. ... In the work of Martin, they are obtained by gradual spatial filtering 1 of the power spectrum of phase perturbations in the assumption of Kolmogorov's model of the optical turbulence (OT). ...

Еще в разделе: (Показать все результаты (>19) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/shtrel_controls.pdf
• http://curl.sai.msu.ru/mass/download/doc/mass_spectral_band_eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf

Cell. ... 2012) 69:1787ґ1797 DOI 10.1007/s00018-011-0895-z Cellular and Molecular Life Sciences REVIEW Cytochrome c: the Achilles' heel in apoptosis A. V. Kulikov Ї E. S. Shilov Ї I. A. Mufazalov Ї V. Gogvadze Ї S. A. Nedospasov Ї B. Zhivotovsky Received: 5 September 2011 / Revised: 30 October 2011 / Accepted: 22 November 2011 / Published online: 17 December 2011 с Springer Basel AG 2012 Abstract Cytochrome c is a well-known ... How is cytochrome c released from mitochondria? ...

Еще в разделе: (Показать все результаты (>7) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/about/struct/labs/lima/paper7.pdf

... Полная версия этой страницы: black drop effect проявление аберрации . Студенческий форум Физфака МГУ > Наука физика > Проверка теорий на прочность . ... При наблюдении прохождения планеты через солнечный диск наблюдается black drop effect. Построим траекторию луча света от Солнца для наблюдателя на Венере (или Меркурии). ... Отсутствие света это тьма. ... Что мы наблюдаем на Земле? black drop effect ! ... Судя по black drop effect это происходит на растояниях сравнимых с диаметром планеты. ...

Еще в разделе: (Показать все результаты (>379) - wasp.phys.msu.ru/ )

• black drop effect проявление аберрации - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > конференция Касперского
• Студенческий форум Физфака МГУ > Предствление Гейзенберга в случае

... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...

Еще в разделе: (Показать все результаты (>19) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_discrete-sequential.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_amplitudes.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_a-sequential-growth.pdf

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>7) - www.sciencepark.ru/ )

• MSU Science Park - Projects & Partners

... All the galaxies are divided into 4 groups depending on the environment type; every subsample contains more than 10 galaxies. ... An effect of environments is seen both for the nuclei and for the bulges: if we consider the clusters (Virgo and Ursa Ma jor) and group centers as dense environments and the field and group periphery as sparse environments, then in the dense environments the stellar populations of S0s are in average older by 4ґ5 Gyr than in the sparse ones. ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/aa6758-06.pdf
• http://sn.sai.msu.ru/~sil/preprints/mykukar.pdf
• http://sn.sai.msu.ru/~sil/preprints/aspb121.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out