Электронная библиотека Попечительского совета . ... Mullins C.S. - Database Administration: The Complete Guide to Practices and Procedures . ... Название: Database Administration: The Complete Guide to Practices and Procedures . ... With Database Administration, database professionals now have a comprehensive sourcebook of strategies for delivering quality administration across today's challenging multi-DBMS environments. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>112032) - lib.mexmat.ru/ )

• Alapati S. - OCP Oracle Database 11g New Features for Administrators Exam Guide
• Loney K. - Oracle Database 10g: The Complete Reference :: Электронная
• Woody B. - Administrator's Guide to SQL Server 2005 :: Электронная библиотека

QuickList . QuickList is an application that allows novice and experienced users to keep track of "things" without any help from a system administrator. Things" can be anything, including bug lists, phone lists, restaurants, team members, calendars, cool urls,checkbooks, fishing holes, CDs, bunjee jumping cool sites, etc. ... If you liked the Appleworks or Microsoft Works databases, you will like QuickList. ... Home Site: . ... User Comments: . ... SAL Home | ... Utilities Other DBMS . ...

Еще в разделе: (Показать все результаты (>2328) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS - Oracle Products
• SAL- Database Systems - Object-Oriented DBMS - ozone
• SAL- Database Systems - Utilities Other DBMS - barracuda

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4909) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

... тЬО intas:cern-intas03:task2 ]] . THEP . ... GRID monitoring tools ===== Task coordinator : Yu. Ryabov, belonging to team: PNPI ==== Objectives : ==== Creation of a tool providing users with access to detailed application information in the framework of the GRID paradigm and test it in LCG. ... Development of monitoring tools that produce integrated characteristics by use of statistical information gathered from various GRID elements. ... Development of the database structure. ...

Еще в разделе: (Показать все результаты (>961) - theory.sinp.msu.ru/ )

• [RU-NGI] apel EMI3
• intas:cern-intas03:task2 [THEP]
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2109) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

You are here: Foswiki > Main Web > WikiUsers > ВикторМалышко (31 Aug 2009, RegistrationAgent ) E dit A ttach . ... Note: if personal data is being stored using a secret database, then it is only visible to the user and to administrators. ... Show tool-tip topic info on mouse-over of WikiWord links, on or off: . ... ChangePassword for changing your password . ChangeEmailAddress for changing your email address . ... Address . ... Topic revision: r1 - 31 Aug 2009, RegistrationAgent . Main . ...

Еще в разделе: (Показать все результаты (>5560) - wiki.cmc.msu.ru/ )

• AnTi < Main < Foswiki
• AnatolyGulyaev < Main < Foswiki
• AlGr < Main < Foswiki

ATasteOfTWiki - view a short introductory presentation on TWiki for beginners . WelcomeGuest - starting points on TWiki . TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... ChangePassword for changing your password . ChangeEmailAddress for changing your email address . TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . UserToolsCategory lists all TWiki user tools . ... Address: . ...

Еще в разделе: (Показать все результаты (>35593) - dualopt1.cmm.msu.ru/ )

• AlexKopylov - Main - TWiki - (printable)
• ElenaZavyalova - Main - TWiki - (printable)
• %TOPICTITLE% (6 vs. 10) - TWiki

... Список форумов | ... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Servant >> Forum (Archive) . ... Во всех разделах перед списком постов такая фигня: . ... Re: Во всех разделах перед списком постов такая фигня: [ re: Oks ] . ...

Еще в разделе: (Показать все результаты (>2164) - www.snto-msu.net/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>7853) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>129) - www.genebee.msu.ru/ )

... Finally you should be able to complete the installation of postfixadmin by pointing your browser at: http://${VHOST_HOSTNAME}/${VHOST_APPDIR}/setup.php Postfix Admin contains 3 views of administration: 1. Site Admin view, located at http://${VHOST_HOSTNAME}/${VHOST_APPDIR}/admin/. ... Domain Admin view, located at http://${VHOST_HOSTNAME}/${VHOST_APPDIR}/. ... User Admin View, located at http://${VHOST_HOSTNAME}/${VHOST_APPDIR}/users/. ... Run: http://${VHOST_HOSTNAME}/${VHOST_APPDIR}/setup.php ...

Еще в разделе: (Показать все результаты (>16836) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/www-apps/mediawiki/files/postinstall-1.18-en.txt
• http://mirror.msu.net/pub/gentoo-portage/www-apps/coppermine/files/postinstall-en.txt
• http://mirror.msu.net/pub/slackware-current/slackware/a/aaa_terminfo-5.9-i486-1.txt

... My address: s570959@tfh-berlin.de ---------README.TXT contents follows:------------------------------------------ ====================================== THE COMPLETE BEATLES SONG-BOOK PROJECT ====================================== Version 0.1, 12-Nov-1995 Launched and coordinated by Dimitri Bragin: s570959@tfh-berlin.de (e-mail) The newest version of beatls??.zip is always on ftp.uwp.edu (204.95.162.190) /pub/music/lyrics/b/beatles/beatls??.zip THIS PROJECT IS BY NO MEANS COMMERCIAL. ...

Еще в разделе: (Показать все результаты (>1987) - crydee.sai.msu.ru/ )

• Work notes

Next: Contents Up: The Network Administrators' Guide . ... UUCP Networks . ... IP Routing . ... Kernel Configuration . Kernel Options in 1.0 and Higher . ... Writing hosts and networks Files . ... Using Options Files . ... The Network File System . ... UUCP Configuration Files . ... Taylor Configuration Files . General Configuration Options-- the config File . How to Tell UUCP about other Systems-- the sys File . ... Mail Routing in the UUCP World . ... Writing the Configuration Files . ...

Еще в разделе: (Показать все результаты (>369) - itpm.msu.su/ )

• Getting smail Up and Running
• The Network File System
• Creating a user

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>760) - monkey.belozersky.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

How To Register to Use SciFinderў Introduction SciFinder's web-based user registration form allows you to create your own SciFinder username and password. The URL for the form is provided by your institution's SciFinder administrator or librarian. ... After you submit the form, CAS sends you an e-mail message with instructions for completing the registration process. ... A message indicates that you will receive an e-mail message from CAS at the address you provided within the form. ...

Еще в разделе: (Показать все результаты (>180) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>441) - oit.cmc.msu.ru/ )

• Database issues
• Database (dbm-style) abstraction layer functions
• Complete list of configure options

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>116) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>151) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и