... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>7278) - monkey.belozersky.msu.ru/ )

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>304) - www.genebee.msu.ru/ )

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>6743) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~golergka/term3/practice4/bln_trna.search

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4914) - cdfe.sinp.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>101) - npidb.belozersky.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>39) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>636) - oit.cmc.msu.ru/ )

Items Added in September & October, 1998: . ... 1998/10/23] . ... Oracle -- powerful database server and applications.[1998/10/23] . ozone -- a multi-user object-oriented database implemented completely in Java.[ ... FC-Plot -- a scientific analysis/visualization tool for Unix/GTK.[ ... eXsas -- extended scientific analysis system for X-ray and XUV data.[ ... Linux Office 99 -- a comprehensive software package of various office applications.[ ... SAL Home | New Items Page | ...

Еще в разделе: (Показать все результаты (>4054) - www.sai.msu.su/ )

• SAL- Database Systems - Object-Oriented DBMS - ROL
• SAL- Other Scientific Fields - Chemistry, Biology Related - HMMER
• SAL- Database Systems - Utilities Other DBMS - FlagShip

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>47299) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm_n.blast
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 56bea23d3c73 lib/sequence.py

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>12293) - mouse.belozersky.msu.ru/ )

• PLANdbAffy: probe-level annotation database for Affymetrix expression
• Geometrical core
• SVETKA, a program for multiple sequence alignments analysis

Электронная библиотека Попечительского совета . ... Loney K. - Oracle Database 10g: The Complete Reference . ... Название: Oracle Database 10g: The Complete Reference . Автор: Loney K. Аннотация: . Get a thorough understanding of Oracle Database 10g from the most comprehensive Oracle database reference on the market, published by Oracle Press. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>17053) - lib.mexmat.ru/ )

• Mullins C.S. - Database Administration: The Complete Guide to Practices and
• Heggins D., Taylor W. - Bioinformatics: Sequence, Structure and Databanks ::
• Brown S.M. - Bioinformatics: A Biologist's Guide to Biocomputing and the

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>192) - lnfm1.sai.msu.ru/ )

Application of evolutionary model in the evaluation of the quality of pair wise alignment of amino acid sequences Valery Polyanovsky, V. G. Tumanyan Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia ... : polyanovskyvo@mailfrom.ru, tuman@eimb.ru The purpose of the work is to develop a universal method for estimating the pairwise alignment quality depending on the evolutionary distance (degree of homology) between the ... REFERENCES 1. ...

Еще в разделе: (Показать все результаты (>373) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/162.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf
• MCCMB'11 posters

Data structuring and formalization in the hybrid database on molecular spectral constants (ISMOL)" . Kochikov I.V., Kuramshina G.M., Samkov L.M., Sharapov L.A., Sharapova S.A. This paper presents the principles of data representation and structuring in the information system ISMOL - a hybrid database on molecular constants of organic compounds existing in raw oil and its refinement products. ... Kochikov I.V. e-mail: kochikov@tm-net.ru . Kuramshina G.M. e-mail: kuramshi@phys.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>253) - num-meth.srcc.msu.ru/ )

• The "Areola" system database

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>255) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• GML C++ Camera Calibration Toolbox | Graphics and Media Lab

... Algorithm & . Format requirements . Contact us . Gallery of examples . SDPsite was applied to 124 families fron the Pfam database . ...

Еще в разделе: (Показать все результаты (>147) - bioinf.fbb.msu.ru/ )

• SDPsite
• SDPsite - Algorithm Format requirements
• Site Cluster

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

... Goals and Tasks . ... Fellows of the Room . ... molecular-genetic study . The Room for Molecular Diagnostics Methods as an independent subdivision of the SIEE was organized in 2003. ... In 2003 a gathering of technical basis of the room was undertaken. й Meschersky, I.G., Chichkina, A.N., Shpak, O.V., Rozhnov, V.V. й A.N. Severtsov Institute of Ecology and Evolution of RAS, 2013 . ... The database will be extended as new samples analysis will done. ...

Еще в разделе: (Показать все результаты (>5873) - www.sevin.ru/ )

• Laboratories: Molecular Diagnostics Methods Room: Results
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News
• WEB-site and informational portal www.sevin.ru

This home page belongs to small group of scientists working at . Sternberg Astronomical Institute which is a part of Moscow State University . ... Электронная библиотека научно-технической и художественной литературы (доступна только из ГАИШ) . ... Local staff . Dr. Edward Kononovich (konon -at- sai.msu.ru), Associate Professor . ... Dr. Sergey Ayukov (asv -at- sai.msu.ru), Research Fellow, Webmaster of the group . ... Joint seminar of Solar Studies Structure Group and Solar Photometry Group . ...

Еще в разделе: (Показать все результаты (>3515) - crydee.sai.msu.ru/ )

• Work notes

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>30) - seac47-2.phys.msu.ru/ )