... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>5951) - kodomo.cmm.msu.ru/ )

• Result summary blast-20091031-1941229237

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6994) - mouse.belozersky.msu.ru/ )

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>2214) - monkey.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysus
• Homeodomain numeration assumed

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>959) - oit.cmc.msu.ru/ )

Электронная библиотека Попечительского совета . ... Mullins C.S. - Database Administration: The Complete Guide to Practices and Procedures . ... Название: Database Administration: The Complete Guide to Practices and Procedures . ... With Database Administration, database professionals now have a comprehensive sourcebook of strategies for delivering quality administration across today's challenging multi-DBMS environments. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>12308) - lib.mexmat.ru/ )

• Loney K. - Oracle Database 10g: The Complete Reference :: Электронная
• Loney K., Koch G. - Oracle8i: The Complete Reference :: Электронная библиотека
• Andersen V. - Microsoft Office Access 2007: The Complete Reference ::

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>200) - www.genebee.msu.ru/ )

• BLAST Basic Overview
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>36) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

Oracle Products . The availablility of Oracle products on Linux will enable users of Linux to deploy enterprise class applications with unparalleled performance at the lowest possible cost. ... Oracle currently has following products available for Linux: . WebDB -- complete and cost-effective solution for building, deploying, and proactively monitoring Web database applications and content-driven Web sites. ... Oracle8 Server -- database management system. ... SAL Home | ... Relational DBMS . ...

Еще в разделе: (Показать все результаты (>5160) - www.sai.msu.su/ )

• SAL- Database Systems - Utilities Other DBMS - CodeBase
• SAL- Other Scientific Fields - Chemistry, Biology Related - Sequin
• SAL- Database Systems - Relational DBMS - DBGUI

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>91074) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• allpy: lib/block.py annotate
• allpy: 56bea23d3c73 lib/block.py

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4911) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>135) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.

... Complete proteomes were extracted from these genomes and domain architectures were assigned to each protein using the Pfam domain database [6] and the COGs database [5]. ... PF02874 (CL0275) ATP-synt_ab_N (ATP synthase alpha/beta family, beta-barrel domain) PF00006 (CL0023) ATP-synt_ab (ATP synthase alpha/beta family, nucleotide-binding domain) PF00306 (\N) PF00231 (\N) PF00119 (\N) PF00137 (\N) ATP-synt_ab_C (ATP synthase alpha/beta chain, C terminal domain) ATP-synt (ATP synthase) Figure 1. ...

Еще в разделе: (Показать все результаты (>300) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/111.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/161.pdf

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>162) - comet.sai.msu.ru/ )

• Filename completion
• Command name completion
• Filename completion with the C shell

... Next: Article Batching Up: C-News Previous: The sys file . The active file is located in /usr/lib/news and lists all groups known at your site, and the articles currently online. ... Entries take the following form: newsgroup high low perm newsgroup is, of course, the group's name. low and high are the lowest and highest numbers of articles currently available. ... This group has been disabled locally. ... This marks newsgroup as being a local alias for another group, namely real-group. ...

Еще в разделе: (Показать все результаты (>545) - itpm.msu.su/ )

• mod_auth_dbm - Apache HTTP Server
• Module Index - Apache HTTP Server
• The DNS Database

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>10) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>20934) - mirror.msu.net/ )

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>42) - www.kosmofizika.ru/ )

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

. Laboratory for Neurophysiology and Neuro-Computer Interfaces . M.V.Lomonosov Moscow State University . Faculty of Biology . EEG Records Databases . EEG Databases available: . EEG of healthy adolescents and adolescents with symptoms of schizophrenia . Event-related potentials in a moving matrix modification of the P300 BCI . Other databases will be available soon.

Еще в разделе: (Показать все результаты (>34) - brain.bio.msu.ru/ )

• EEG Database - Schizophrenia