... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>52) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>399) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>3463) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Правительство Канады расширяет программу Canadian
• Клуб выпускников МГУ: Какие документы требуют при приеме на работу
• Клуб выпускников МГУ: Изменились порядок подачи документов, сроки и стоимость

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>78) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>139) - srcc.msu.ru/ )

• Leading scientific fellow Sergey Piskarev Ph.D.
• M. Li, S. Piskarev. On the approximation of integrated semigroups // Taiwanese
• Piskarev S. On approximation of integrated semigroups // International

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>107) - polly.phys.msu.ru/ )

• About me
• NATO Scientific Environmental Affairs
• NATO Scientific & Environmental Affairs

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>183) - uneex.mithril.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>832) - uneex.lorien.cs.msu.su/ )

• Module Index - Apache HTTP Server
• Глава 5. Подробное руководство по сохранению документов и печати
• Документы для разработчиков ALT Linux

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>147) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>1388) - www.mgubs.ru/ )

• Заканчивается прием документов на программу "Магистр" (дополнительный набор)
• НОРМАТИВНЫЕ ДОКУМЕНТЫ | Высшая школа бизнеса МГУ им. Ломоносова
• Прием документов на Executive MBA

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>346) - www.fadr.msu.ru/ )

• THE ALBANIAN AGRICULTURAL SECTOR IN TRANSITION
• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>84) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>18) - www.issp.ac.ru/ )

... Студенческий совет Деятельность Календарь Студсовета ФГУ Медиа Газета 'Управленец' Форум 'Ответственное поколение' . ... E-mail: Golionko@spa.msu.ru . Office phone: 7-(495)-939-53-72 . ... For participants from Russia and CIS countries . ... VISA SUPPORT APPLICATION FORM . ... Date of entry to Russia . ... Date of exit from Russia . ... Contact phone . ... Contact e-mail . ... Russian consulate you intend to apply for your visa (country and city) . ... Contact fax number and e-mail . ...

Еще в разделе: (Показать все результаты (>1076) - www.spa.msu.ru/ )

• Visa Support Information
• Прием документов
• Нормативные документы

. www.snto.ru Главная . О Cовете . Состав совета . Информация о Cовете . Совет по делам молодежи . Деятельность . Стенограммы заседаний . Актуальные темы . Новости . Последние публикации . Архив новостей . Видеоновости . Госпремия . О премии . Лауреаты . Оформление документов . Документы . Аналитические сведения . Статистика . Нормативные документы . Государственная политика . This is replaced by the Flash movie. Опубликовано: 01.04.2016 г. Опубликовано: 10.02.2016 г. Карта сайта .

Еще в разделе: (Показать все результаты (>2) - www.snto.ru/ )

... 10, 63 ґ 64 (2010) / DOI 10.1002/pamm.201010024 Integrability and nonintegrability in terms of transcendental functions in dynamics of a rigid body Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., ... This circumstance allowed the author to perform a complete analysis of all phase trajectories and highlight those properties of them which exhibit the roughness and preserve for systems of a more general form. c 2010 Wiley-VCH Verlag GmbH & Co. ...

Еще в разделе: (Показать все результаты (>37) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-136-1.pdf
• Maxim V. Shamolin Home Page

Below is a list of all of the modules that come as part of the Apache distribution. ... mod_setenvif Apache 1.3 and up . ... mod_unique_id Apache 1.3 and up . ... Determining document types using file extensions . ... mod_rewrite Apache 1.2 and up . ... User authentication using text files . ... User authentication using DBM files . ... User authentication using Berkeley DB files . mod_auth_anon Apache 1.1 and up . ... User-configurable logging replacement for mod_log_common . ...

Еще в разделе: (Показать все результаты (>48) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache module mod_dir
• Definitions of terms used to describe Apache directives

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>137) - herba.msu.ru/ )

• Publications about flora
• Complete flora of islands and lakes as a statistical hypothesis
• Общие документы

... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...

Еще в разделе: (Показать все результаты (>4) - www.fnm.msu.ru/ )