... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>286) - www.genebee.msu.ru/ )

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>6940) - monkey.belozersky.msu.ru/ )

Items Added in September & October, 1998: . ... 1998/10/23] . ... Oracle -- powerful database server and applications.[1998/10/23] . ozone -- a multi-user object-oriented database implemented completely in Java.[ ... FC-Plot -- a scientific analysis/visualization tool for Unix/GTK.[ ... eXsas -- extended scientific analysis system for X-ray and XUV data.[ ... Linux Office 99 -- a comprehensive software package of various office applications.[ ... SAL Home | New Items Page | ...

Еще в разделе: (Показать все результаты (>3619) - www.sai.msu.su/ )

• SAL- Database Systems - Utilities Other DBMS - FlagShip
• SAL- Database Systems - Object-Oriented DBMS - ROL
• SAL- Database Systems - Utilities Other DBMS - D-ISAM DISAM96

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4914) - cdfe.sinp.msu.ru/ )

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>6407) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>560) - oit.cmc.msu.ru/ )

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>231) - lnfm1.sai.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>39791) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~sorochkinaa/term2/SRS_tables.doc

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>38) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Электронная библиотека Попечительского совета . ... Loney K. - Oracle Database 10g: The Complete Reference . ... Название: Oracle Database 10g: The Complete Reference . Автор: Loney K. Аннотация: . Get a thorough understanding of Oracle Database 10g from the most comprehensive Oracle database reference on the market, published by Oracle Press. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>20465) - lib.mexmat.ru/ )

• Mullins C.S. - Database Administration: The Complete Guide to Practices and
• Doyle J.F. - Modern experimental stress analysis : completing the solution of
• Allen R.L., Mills D.W. - Signal analysis. Time, frequency, scale and structure

... Computer software has been developed for crystal chemistry analysis of arrangement of molecules in organic crystals on the basis of concepts worked out in the studies conducted by P.M.Zorky et al. ... The standard crystal chemistry analysis includes: . ... Constructing various graphic representations of the crystal structure and of its fragments, which clearly demonstrate arrangement of molecules, in particular, constructing representations of the most close molecule-molecule contacts. ...

Еще в разделе: (Показать все результаты (>1134) - chem.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

Evolution and Classification of GH101 Family Glycoside Hydrolases: Four Years Later Daniil G. Naumoff S. N. Winogradsky Institute of Microbiology, Russian Academy of Sciences, Prospekt 60-letiya Oktyabrya 7/2, Moscow 117312, Russia; daniil_naumoff@yahoo.com Recent progress in geno me sequencing resulted in a rapid growth of the sequence databases. The number of known representatives of all protein families has increased dramat ically. ... This family was described in 2005 [2]. ...

Еще в разделе: (Показать все результаты (>357) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/178.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/96.pdf

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>308) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Medical image analysis | Graphics and Media Lab

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>11970) - mouse.belozersky.msu.ru/ )

• S : rm_systems
• S : 3D_of_rm_system_components

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>75) - brain.bio.msu.ru/ )

• S.Borisov
• Unsolved problems and new prospects
• Change-points in EEG components with different pattern

. The "Areola" system database . Bryzgalov P.A. The paper describes the database of the "Areola" system - a program shell for creating online encyclopedia. In particular, the database structure, the processes of initial data input, detecting errors and editing information in the database are described. PostScript (in Russian) (104KB) . PDF (in Russian) (108KB) . PostScript. zip (in Russian) (30.4KB) . PDF. zip (in Russian) (43KB) . Bryzgalov P.A. e-mail: pyotr777@guru.ru

Еще в разделе: (Показать все результаты (>321) - num-meth.srcc.msu.ru/ )

• "Data structuring and formalization in the hybrid database on molecular
• A system for analysis of information structure of programs.

... Goals and Tasks . ... Fellows of the Room . ... molecular-genetic study . The Room for Molecular Diagnostics Methods as an independent subdivision of the SIEE was organized in 2003. ... In 2003 a gathering of technical basis of the room was undertaken. й Meschersky, I.G., Chichkina, A.N., Shpak, O.V., Rozhnov, V.V. й A.N. Severtsov Institute of Ecology and Evolution of RAS, 2013 . ... The database will be extended as new samples analysis will done. ...

Еще в разделе: (Показать все результаты (>5347) - www.sevin.ru/ )

• Laboratories: Laboratory for Soil Zoology and General Entomology: Goals and
• Laboratories: Molecular Diagnostics Methods Room: Results
• Экологический Форум - Фундаментальная Экология: Over virtually the complete

... Algorithm & . Format requirements . Contact us . Gallery of examples . SDPsite was applied to 124 families fron the Pfam database . ...

Еще в разделе: (Показать все результаты (>146) - bioinf.fbb.msu.ru/ )

• SDPsite
• SDPsite - Algorithm Format requirements
• RNA Kinetics: Theory

Key-words: rhythm, stress, syllable, rhythmic structure, syntagm, utterance, prosody, speech production, speech perception . ... In speech communication, RS are both units of speech production and speech perception. ... The research of speech rhythm in diachrony and synchrony consists of the analysis and the description of speech rhythmic units concerning Old Church Slavonic, Old Russian, Old High German in diachrony and Modern Russian, German, Czech and Bulgarian in synchrony. ...

Еще в разделе: (Показать все результаты (>365) - www.philol.msu.ru/ )