... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>137) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description
• General Catalogue of Variable Stars: Homepage.
• GCVS Query forms

General Catalog of Variable Stars (GCVS database, Version 2013Jun) . Samus N.N., Durlevich O.V., Kazarovets E V., Kireeva N.N., Pastukhova E.N., Zharova A.V., et al. ... General Catalogue of Variable Stars (Samus+ 2007-2012), VizieR On-line Data Catalog: B/gcvs . ... Query forms by files . The values in the input file must be separeted by comas or arranged in columns. ... Enter the file with the GCVS names: . ... Enter the file with the coordinates J2000.0: . ...

Еще в разделе: (Показать все результаты (>8) - www.sai.msu.ru/ )

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>240) - comet.sai.msu.ru/ )

• Filename completion with the C shell
• Special shell variables
• Useful mail variables

Электронная библиотека Попечительского совета . ... Loney K. - Oracle Database 10g: The Complete Reference . ... Название: Oracle Database 10g: The Complete Reference . Автор: Loney K. Аннотация: . Get a thorough understanding of Oracle Database 10g from the most comprehensive Oracle database reference on the market, published by Oracle Press. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>13755) - lib.mexmat.ru/ )

• Mullins C.S. - Database Administration: The Complete Guide to Practices and
• Bochner S., Martin W.T. - Several Complex Variables :: Электронная библиотека
• Green G.M. - On the Linear Dependence of Functions of Several Variables, and

Alexey Rastorguev's links to DataBases and Catalogs: . ... Open Clusters and Galactic Structure База данных и каталог рассеянных скоплений Галактики . ... USNO: Astronomical Applications Каталоги и базы данных - проекты Морской Обсерватории США . ... HST Science Data Archive Архив данных HST . CFHT Data Archive Архив данных CFHT . ... USNO Recommended Star Catalogs (Zacharias N. et al.) ... USNO Star Catalogs Каталоги USNO . ... USNO-B1.0 Catalog Астрометрический каталог USNO-B1.0 . ...

Еще в разделе: (Показать все результаты (>429) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Data bases of Natural Satellites. Documentation. Sources

This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>19) - astrometric.sai.msu.ru/ )

ATasteOfTWiki - view a short introductory presentation on TWiki for beginners . WelcomeGuest - starting points on TWiki . TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... ChangePassword for changing your password . ChangeEmailAddress for changing your email address . TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . UserToolsCategory lists all TWiki user tools . ... Address: . ...

Еще в разделе: (Показать все результаты (>40810) - dualopt1.cmm.msu.ru/ )

• AndreyGolovin - Main - TWiki - (printable)
• ElenaZavyalova - Main - TWiki - (printable)
• %TOPICTITLE% (14 vs. 15) - TWiki

Peremennye Zvezdy", . ... Max . ... 2MASS J06580722-3837534 . ... max . ... Comm. 1 . ... 12.0 . ... M10 . ... J K = 1.534 (2MASS), GSC 7135-02057. ... J K = 1.411 (2MASS), GSC 7705-01002. ... J K = 1.494 (2MASS), GSC 9215-01971. ... J K = 1.464 (2MASS), GSC 8962-02344. ... J K = 1.617 (2MASS), GSC 8208-00313. ... Astrometric positions were taken from the 2MASS catalogue (Skrutskie et al. 2006); spectral information was derived from the Catalogue of Stellar Spectral Classifications (Skiff 2010). ...

Еще в разделе: (Показать все результаты (>11018) - www.astronet.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4917) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

... EM_PRO:AE004439 . ... Pm70, complete genome. ... EM_PRO:CP000671 . ... Salmonella enterica subsp. enterica serovar Schwarzengrund str. ... Salmonella enterica subsp. arizonae serovar 62:z4,z23:--, complete genome. 4600800 . ... Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594, complete genome. 4833080 . ... Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 complete genome . ... Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome. 4791961 . ...

Еще в разделе: (Показать все результаты (>2234) - kodomo.cmm.msu.ru/ )

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>16) - mouse.belozersky.msu.ru/ )

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>170) - www.genebee.msu.ru/ )

PHP Manual . ... Variables . ... When a form is submitted to a PHP script, any variables from that form will be automatically made available to the script by PHP. ... Simple form variable . form action="foo.php" method="post"> Name: <input type="text" name="username"><br> <input type="submit"> </form> . ... The experienced may note that the actual variable names sent by the browser contains a period rather than an underscore, but PHP converts the period to an underscore automatically. ...

Еще в разделе: (Показать все результаты (>914) - oit.cmc.msu.ru/ )

• Oracle 8 functions
• Informix functions
• swf_closefile

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>136) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• Logic and Databases

... unary minus) .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file , .my.cnf file .mysql_history file .pid (process ID) file . ... Arithmetic functions . ... Bit functions . ... Control flow functions . ... CREATE FUNCTION . CREATE INDEX . ... Date and time functions . ... DBI->{type} . ... DROP FUNCTION . DROP INDEX . ... MYSQL C type . ... MYSQL_FIELD C type . ... MYSQL_FIELD_OFFSET C type . ... MYSQL_RES C type . MYSQL_ROW C type . ... REVERSE() . ...

Еще в разделе: (Показать все результаты (>420) - itpm.msu.su/ )

• Resolver Environment Variables
• mod_setenvif - Apache HTTP Server
• Module Index - Apache HTTP Server

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Kazarovets E.V. , Samus N.N. , Durlevich O.V. , Kireeva N.N. , Pastukhova E.N. в журнале VizieR Online Data Catalog , том 185, с. 96900 . ... Kazarovets E.V. , Samus N.N. , Durlevich O.V. , Kireeva N.N. , Pastukhova E.N. в журнале Information Bulletin on Variable Stars , издательство Konkoly Observatory (Hungary) , ? ...

Еще в разделе: (Показать все результаты (>2421) - istina.msu.ru/ )

• Mingaliev M.G. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Information Bulletin on Variable Stars - журнал | ИСТИНА - Интеллектуальная
• Journal of probability and statistics - журнал | ИСТИНА - Интеллектуальная

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>7545) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• allpy: a17d913cccef docs/Makefile
• allpy: 30225705261a docs/Makefile

A completely new possibility of Fortran 90 is recursion. Note that it requires that you give a new property RESULT for the output variable in the function declaration. ... Here follows two examples, first recursive calculation of the factorial, then recursive calculations of the Fibonacci-numbers. ... The listings of the routines follow, the output variables are called FAC_RESULT and FIBO_RESULT , respectively. ... Not only functions but also subroutines can be recursive. ...

Еще в разделе: (Показать все результаты (>3508) - crydee.sai.msu.ru/ )

• Adding Variables to CONFIG.SYS
• Generic routines
• Historical Notes

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out